Transcript: Mouse XM_006516564.2

PREDICTED: Mus musculus EDAR (ectodysplasin-A receptor)-associated death domain (Edaradd), transcript variant X1, mRNA.

Source:
NCBI, updated 2016-06-22
Taxon:
Mus musculus (mouse)
Gene:
Edaradd (171211)
Length:
4268
CDS:
757..1443

Additional Resources:

NCBI RefSeq record:
XM_006516564.2
NBCI Gene record:
Edaradd (171211)

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Mouse XM_006516564.2, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Mouse Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000364209 CCCACGCTGGAGTTCTTATTC pLKO_005 1222 CDS 100% 13.200 18.480 N Edaradd n/a
2 TRCN0000364208 ACCGGCCTCCCTAAAGCTAAA pLKO_005 871 CDS 100% 10.800 15.120 N Edaradd n/a
3 TRCN0000193902 CCTAAAGCTAAAGAGTGTGAT pLKO.1 880 CDS 100% 4.950 6.930 N Edaradd n/a
4 TRCN0000368868 ATTCCAACTGTCCACCAAATT pLKO_005 908 CDS 100% 13.200 10.560 N Edaradd n/a
5 TRCN0000364259 CGATCAGGACTTGCTAGATAC pLKO_005 1086 CDS 100% 10.800 7.560 N Edaradd n/a
6 TRCN0000173513 GCTGGAGTTCTTATTCCGAAA pLKO.1 1227 CDS 100% 4.050 2.835 N Edaradd n/a
7 TRCN0000194614 GCATGCCCTATGATGAACTGT pLKO.1 1175 CDS 100% 3.000 2.100 N Edaradd n/a
8 TRCN0000173178 CCAAATTCTGATGACCAACCT pLKO.1 922 CDS 100% 2.640 1.848 N Edaradd n/a
9 TRCN0000166364 CACACACACACACACACACAA pLKO.1 1643 3UTR 100% 4.950 2.475 Y KAAG1 n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript XM_006516564.2, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

No results found.