Transcript: Mouse XM_006516840.3

PREDICTED: Mus musculus human immunodeficiency virus type I enhancer binding protein 1 (Hivep1), transcript variant X4, mRNA.

Source:
NCBI, updated 2016-06-22
Taxon:
Mus musculus (mouse)
Gene:
Hivep1 (110521)
Length:
8888
CDS:
238..8373

Additional Resources:

NCBI RefSeq record:
XM_006516840.3
NBCI Gene record:
Hivep1 (110521)

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Mouse XM_006516840.3, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Mouse Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000320969 GTCTTAGAGGCTGGCGTTAAA pLKO_005 334 CDS 100% 13.200 18.480 N Hivep1 n/a
2 TRCN0000009800 CGGTATCGAATCCCGAATCTT pLKO.1 1802 CDS 100% 5.625 7.875 N Hivep1 n/a
3 TRCN0000321035 CGGTATCGAATCCCGAATCTT pLKO_005 1802 CDS 100% 5.625 7.875 N Hivep1 n/a
4 TRCN0000009796 GCGTAGTGAAACCTTATCAAA pLKO.1 3984 CDS 100% 5.625 7.875 N Hivep1 n/a
5 TRCN0000004979 CCCAGCAAATAGTTTAGACAT pLKO.1 5442 CDS 100% 4.950 6.930 N HIVEP1 n/a
6 TRCN0000321038 ATGATATGTTGCACTGTTAAA pLKO_005 8690 3UTR 100% 13.200 10.560 N Hivep1 n/a
7 TRCN0000321036 GACACTCAACAGCCGTCATTT pLKO_005 5974 CDS 100% 13.200 10.560 N Hivep1 n/a
8 TRCN0000321037 GAGCTAATGAGAGCCATAAAC pLKO_005 5552 CDS 100% 13.200 9.240 N Hivep1 n/a
9 TRCN0000009798 GCAATAAAGATGACTCTGAAA pLKO.1 6311 CDS 100% 4.950 3.465 N Hivep1 n/a
10 TRCN0000009797 GCGTTCGATGTCTTACTGAAA pLKO.1 820 CDS 100% 4.950 3.465 N Hivep1 n/a
11 TRCN0000009799 GCTGCTAATTTGACTCAGGTT pLKO.1 5677 CDS 100% 2.640 1.848 N Hivep1 n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript XM_006516840.3, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

No results found.