Transcript: Mouse XM_006516937.2

PREDICTED: Mus musculus transmembrane protein 14C (Tmem14c), transcript variant X1, mRNA.

Source:
NCBI, updated 2016-06-22
Taxon:
Mus musculus (mouse)
Gene:
Tmem14c (66154)
Length:
1022
CDS:
7..600

Additional Resources:

NCBI RefSeq record:
XM_006516937.2
NBCI Gene record:
Tmem14c (66154)

sgRNA constructs matching this transcript (CRISPRko, NGG PAM)

This list includes CRISPRko constructs with 100% (20mer + NGG) sequence match to the coding regions of this transcript.

No results found.

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Mouse XM_006516937.2, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Mouse Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000009763 CCTCCACATTACAATGTTGAA pLKO.1 647 3UTR 100% 4.950 3.960 N Tmem14c n/a
2 TRCN0000314171 CCTCCACATTACAATGTTGAA pLKO_005 647 3UTR 100% 4.950 3.960 N Tmem14c n/a
3 TRCN0000009764 CAAAGTTGGAATTAGTCTGTT pLKO.1 561 CDS 100% 4.950 3.465 N Tmem14c n/a
4 TRCN0000009765 AGTTTGCTGATGGTTGCCAAA pLKO.1 544 CDS 100% 4.050 2.835 N Tmem14c n/a
5 TRCN0000314170 AGTTTGCTGATGGTTGCCAAA pLKO_005 544 CDS 100% 4.050 2.835 N Tmem14c n/a
6 TRCN0000009767 CCTAGCTACATCTGGGACCTT pLKO.1 453 CDS 100% 2.640 1.848 N Tmem14c n/a
7 TRCN0000314229 CCTAGCTACATCTGGGACCTT pLKO_005 453 CDS 100% 2.640 1.848 N Tmem14c n/a
8 TRCN0000009766 GTGGGATTATTGGCTATGCCA pLKO.1 329 CDS 100% 0.750 0.525 N Tmem14c n/a
9 TRCN0000350113 GTGGGATTATTGGCTATGCCA pLKO_005 329 CDS 100% 0.750 0.525 N Tmem14c n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript XM_006516937.2, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

No results found.