Transcript: Mouse XM_006516955.4

PREDICTED: Mus musculus caspase recruitment domain family, member 19 (Card19), transcript variant X1, mRNA.

Source:
NCBI, updated 2019-08-08
Taxon:
Mus musculus (mouse)
Gene:
Card19 (68480)
Length:
787
CDS:
126..617

Additional Resources:

NCBI RefSeq record:
XM_006516955.4
NBCI Gene record:
Card19 (68480)

sgRNA constructs matching this transcript (CRISPRko, NGG PAM)

This list includes CRISPRko constructs with 100% (20mer + NGG) sequence match to the coding regions of this transcript.

No results found.

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Mouse XM_006516955.4, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Mouse Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000190543 GAACGGCACTGTCAGGAATTT pLKO.1 345 CDS 100% 13.200 9.240 N Card19 n/a
2 TRCN0000241111 CCTTCTCACCTGTCATCATTG pLKO_005 538 CDS 100% 10.800 7.560 N Card19 n/a
3 TRCN0000241110 ATCCTCCAGCTGAACCGTTAC pLKO_005 219 CDS 100% 6.000 4.200 N Card19 n/a
4 TRCN0000268842 ATCCTCCAGCTGAACCGTTAC pLKO_005 219 CDS 100% 6.000 4.200 N CARD19 n/a
5 TRCN0000241108 ATGACCTCGGAGGACTCTGAT pLKO_005 598 CDS 100% 4.950 3.465 N Card19 n/a
6 TRCN0000190818 GCAACAAGTGGACAGGATCAT pLKO.1 200 CDS 100% 4.950 3.465 N Card19 n/a
7 TRCN0000241109 TGACCTCCTGAGCCATCTACA pLKO_005 314 CDS 100% 4.950 3.465 N Card19 n/a
8 TRCN0000241112 ACCGAGCTCTGTACATCCATG pLKO_005 367 CDS 100% 4.050 2.835 N Card19 n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript XM_006516955.4, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

No results found.