Transcript: Mouse XM_006516974.3

PREDICTED: Mus musculus WNK lysine deficient protein kinase 2 (Wnk2), transcript variant X13, mRNA.

Source:
NCBI, updated 2016-06-22
Taxon:
Mus musculus (mouse)
Gene:
Wnk2 (75607)
Length:
9735
CDS:
816..7163

Additional Resources:

NCBI RefSeq record:
XM_006516974.3
NBCI Gene record:
Wnk2 (75607)

sgRNA constructs matching this transcript (CRISPRko, NGG PAM)

This list includes CRISPRko constructs with 100% (20mer + NGG) sequence match to the coding regions of this transcript.

No results found.

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Mouse XM_006516974.3, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Mouse Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000360824 GGTGCATGATCCGGAGATTAA pLKO_005 2075 CDS 100% 13.200 18.480 N Wnk2 n/a
2 TRCN0000360752 TTGACGGACAAACCTAGTTTC pLKO_005 4428 CDS 100% 10.800 15.120 N Wnk2 n/a
3 TRCN0000360826 ACAATGGAGCCATAGAGTTTA pLKO_005 2290 CDS 100% 13.200 10.560 N Wnk2 n/a
4 TRCN0000027661 CACGGGAAAGAGGTGGTTTAT pLKO.1 4286 CDS 100% 13.200 9.240 N Wnk2 n/a
5 TRCN0000027590 CCCTCCTGTGACTACTGTAAT pLKO.1 4529 CDS 100% 13.200 9.240 N Wnk2 n/a
6 TRCN0000027606 CAGAGTCATCTTCCAGCAATA pLKO.1 5296 CDS 100% 10.800 7.560 N Wnk2 n/a
7 TRCN0000027591 CCTGAAATGTACGAGGAACAT pLKO.1 1911 CDS 100% 4.950 3.465 N Wnk2 n/a
8 TRCN0000027668 CTGAAGGAAATCTCGGAGCTA pLKO.1 6069 CDS 100% 2.640 1.848 N Wnk2 n/a
9 TRCN0000194773 CCTATAAGTCTAGTAGCAAAC pLKO.1 6487 CDS 100% 6.000 4.200 N WNK2 n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript XM_006516974.3, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

No results found.