Transcript: Mouse XM_006517011.3

PREDICTED: Mus musculus kelch-like 3 (Klhl3), transcript variant X3, mRNA.

Source:
NCBI, updated 2016-06-22
Taxon:
Mus musculus (mouse)
Gene:
Klhl3 (100503085)
Length:
2652
CDS:
248..1915

Additional Resources:

NCBI RefSeq record:
XM_006517011.3
NBCI Gene record:
Klhl3 (100503085)

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Mouse XM_006517011.3, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

No results found.

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript XM_006517011.3, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

Clone ID DNA Barcode Vector Sequenced %[?] Nuc. Match %[?] Prot. Match %[?] Epitope Tag Match Diffs[?] Addgene[?]
1 ccsbBroadEn_11822 pDONR223 100% 40.2% 45.3% None (many diffs) n/a
2 ccsbBroad304_11822 pLX_304 0% 40.2% 45.3% V5 (many diffs) n/a
3 TRCN0000474570 CGTTCATGGGTCCAAATAAACAGA pLX_317 42.7% 40.2% 45.3% V5 (many diffs) n/a
Download CSV