Transcript: Mouse XM_006517163.3

PREDICTED: Mus musculus patched 1 (Ptch1), transcript variant X4, mRNA.

Source:
NCBI, updated 2016-06-22
Taxon:
Mus musculus (mouse)
Gene:
Ptch1 (19206)
Length:
7108
CDS:
429..4322

Additional Resources:

NCBI RefSeq record:
XM_006517163.3
NBCI Gene record:
Ptch1 (19206)

sgRNA constructs matching this transcript (CRISPRko, NGG PAM)

This list includes CRISPRko constructs with 100% (20mer + NGG) sequence match to the coding regions of this transcript.

No results found.

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Mouse XM_006517163.3, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Mouse Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000042542 GCAATGGAAGTTGGAACATTT pLKO.1 560 CDS 100% 13.200 10.560 N Ptch1 n/a
2 TRCN0000326122 GCAATGGAAGTTGGAACATTT pLKO_005 560 CDS 100% 13.200 10.560 N Ptch1 n/a
3 TRCN0000040052 GCGAAGTTTCAGAGACTCTTA pLKO.1 216 5UTR 100% 4.950 3.960 N PTCH1 n/a
4 TRCN0000042539 CCTGTCCTCTTATCCTTCTTT pLKO.1 3489 CDS 100% 5.625 3.938 N Ptch1 n/a
5 TRCN0000326121 CCTGTCCTCTTATCCTTCTTT pLKO_005 3489 CDS 100% 5.625 3.938 N Ptch1 n/a
6 TRCN0000042538 GCTCCTTGATTGGCATTTCTT pLKO.1 1438 CDS 100% 5.625 3.938 N Ptch1 n/a
7 TRCN0000042541 CCGAATATCCAGCACCTACTT pLKO.1 2412 CDS 100% 4.950 3.465 N Ptch1 n/a
8 TRCN0000326120 CCGAATATCCAGCACCTACTT pLKO_005 2412 CDS 100% 4.950 3.465 N Ptch1 n/a
9 TRCN0000010497 TAATCCTCAACTCATGATACA pLKO.1 434 CDS 100% 4.950 3.465 N PTCH1 n/a
10 TRCN0000042540 CCTGCAATTCTCAGCATGGAT pLKO.1 1752 CDS 100% 3.000 1.800 N Ptch1 n/a
11 TRCN0000326195 CCTGCAATTCTCAGCATGGAT pLKO_005 1752 CDS 100% 3.000 1.800 N Ptch1 n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript XM_006517163.3, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

Clone ID DNA Barcode Vector Sequenced %[?] Nuc. Match %[?] Prot. Match %[?] Epitope Tag Match Diffs[?] Addgene[?]
1 ccsbBroadEn_11068 pDONR223 100% 6.3% 7% None (many diffs) n/a
2 ccsbBroad304_11068 pLX_304 0% 6.3% 7% V5 (many diffs) n/a
3 TRCN0000473481 CACGTATCTTCGTGGCCCGCGTTC pLX_317 74.6% 6.3% 7% V5 (many diffs) n/a
Download CSV