Transcript: Mouse XM_006517170.3

PREDICTED: Mus musculus solute carrier family 12, member 7 (Slc12a7), transcript variant X1, mRNA.

Source:
NCBI, updated 2016-06-22
Taxon:
Mus musculus (mouse)
Gene:
Slc12a7 (20499)
Length:
5249
CDS:
76..3429

Additional Resources:

NCBI RefSeq record:
XM_006517170.3
NBCI Gene record:
Slc12a7 (20499)

sgRNA constructs matching this transcript (CRISPRko, NGG PAM)

This list includes CRISPRko constructs with 100% (20mer + NGG) sequence match to the coding regions of this transcript.

No results found.

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Mouse XM_006517170.3, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Mouse Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000351058 AGGTGTAGTCCTGCGAGATAA pLKO_005 1596 CDS 100% 13.200 9.240 N Slc12a7 n/a
2 TRCN0000068368 CGTGACTACATCTTTCATTTA pLKO.1 1539 CDS 100% 13.200 9.240 N Slc12a7 n/a
3 TRCN0000327500 CGTGACTACATCTTTCATTTA pLKO_005 1539 CDS 100% 13.200 9.240 N Slc12a7 n/a
4 TRCN0000068372 GCTTGGAAGGAGGCAGATAAT pLKO.1 2554 CDS 100% 13.200 9.240 N Slc12a7 n/a
5 TRCN0000379346 TGAACAAGCTGGCCAACTATA pLKO_005 419 CDS 100% 13.200 9.240 N Slc12a7 n/a
6 TRCN0000375745 TTGTCGGCAATGGTAGGTATA pLKO_005 3692 3UTR 100% 10.800 7.560 N Slc12a7 n/a
7 TRCN0000068369 CGGCTGCATCTACAAGTACAT pLKO.1 2097 CDS 100% 4.950 3.465 N Slc12a7 n/a
8 TRCN0000363561 CGGCTGCATCTACAAGTACAT pLKO_005 2097 CDS 100% 4.950 3.465 N Slc12a7 n/a
9 TRCN0000068370 GCATCTACTTCCCGTCTGTAA pLKO.1 1436 CDS 100% 4.950 3.465 N Slc12a7 n/a
10 TRCN0000068371 TGGACGAAAGAGAAACTCATT pLKO.1 3103 CDS 100% 4.950 2.970 N Slc12a7 n/a
11 TRCN0000327498 TGGACGAAAGAGAAACTCATT pLKO_005 3103 CDS 100% 4.950 2.970 N Slc12a7 n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript XM_006517170.3, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

No results found.