Transcript: Mouse XM_006517429.3

PREDICTED: Mus musculus kinesin family member 27 (Kif27), transcript variant X3, mRNA.

Source:
NCBI, updated 2016-06-22
Taxon:
Mus musculus (mouse)
Gene:
Kif27 (75050)
Length:
4499
CDS:
267..4451

Additional Resources:

NCBI RefSeq record:
XM_006517429.3
NBCI Gene record:
Kif27 (75050)

sgRNA constructs matching this transcript (CRISPRko, NGG PAM)

This list includes CRISPRko constructs with 100% (20mer + NGG) sequence match to the coding regions of this transcript.

No results found.

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Mouse XM_006517429.3, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Mouse Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000220536 GCAGAGAATTACGTCAGATTT pLKO.1 4339 CDS 100% 13.200 10.560 N Kif27 n/a
2 TRCN0000220537 CGTAAACAACAGTTGCAGAAT pLKO.1 3648 CDS 100% 4.950 3.960 N Kif27 n/a
3 TRCN0000220535 CGAATGGATGAAATGGAATTT pLKO.1 1329 CDS 100% 13.200 9.240 N Kif27 n/a
4 TRCN0000220534 GCAGAAATTAAGAGAGATCAA pLKO.1 2877 CDS 100% 4.950 3.465 N Kif27 n/a
5 TRCN0000220538 GCTGTCAAACTAAATCAGAAA pLKO.1 1548 CDS 100% 4.950 3.465 N Kif27 n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript XM_006517429.3, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

No results found.