Transcript: Mouse XM_006517594.3

PREDICTED: Mus musculus phosphodiesterase 8B (Pde8b), transcript variant X11, mRNA.

Source:
NCBI, updated 2016-06-22
Taxon:
Mus musculus (mouse)
Gene:
Pde8b (218461)
Length:
4443
CDS:
541..2826

Additional Resources:

NCBI RefSeq record:
XM_006517594.3
NBCI Gene record:
Pde8b (218461)

sgRNA constructs matching this transcript (CRISPRko, NGG PAM)

This list includes CRISPRko constructs with 100% (20mer + NGG) sequence match to the coding regions of this transcript.

No results found.

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Mouse XM_006517594.3, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Mouse Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000048733 GCAGCATAATTGCTTGCTATA pLKO.1 893 CDS 100% 10.800 15.120 N PDE8B n/a
2 TRCN0000114904 CGATAACTATAAACACTGGAA pLKO.1 2754 CDS 100% 2.640 3.696 N Pde8b n/a
3 TRCN0000114902 CCCATCACAAAGGTTATAAAT pLKO.1 1522 CDS 100% 15.000 10.500 N Pde8b n/a
4 TRCN0000114901 CCCAAACTTCATTTCCAGAAA pLKO.1 2955 3UTR 100% 4.950 3.465 N Pde8b n/a
5 TRCN0000114903 GCCATAGAAATAACAAGTGAT pLKO.1 1009 CDS 100% 4.950 3.465 N Pde8b n/a
6 TRCN0000114905 GCAAGTGATTGAAGCCAACTA pLKO.1 1971 CDS 100% 4.950 2.970 N Pde8b n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript XM_006517594.3, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

No results found.