Transcript: Mouse XM_006517620.2

PREDICTED: Mus musculus interleukin 31 receptor A (Il31ra), transcript variant X1, mRNA.

Source:
NCBI, updated 2016-06-22
Taxon:
Mus musculus (mouse)
Gene:
Il31ra (218624)
Length:
4488
CDS:
233..2434

Additional Resources:

NCBI RefSeq record:
XM_006517620.2
NBCI Gene record:
Il31ra (218624)

sgRNA constructs matching this transcript (CRISPRko, NGG PAM)

This list includes CRISPRko constructs with 100% (20mer + NGG) sequence match to the coding regions of this transcript.

No results found.

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Mouse XM_006517620.2, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Mouse Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000089339 GCTCTACGATTCAGGTTCAAT pLKO.1 839 CDS 100% 5.625 7.875 N Il31ra n/a
2 TRCN0000089341 GCCGTATTCAATCCAAGCTTA pLKO.1 1468 CDS 100% 4.950 6.930 N Il31ra n/a
3 TRCN0000089340 CCGTATTCAATCCAAGCTTAT pLKO.1 1469 CDS 100% 10.800 8.640 N Il31ra n/a
4 TRCN0000089342 GCTGGTAGTGAACTTTGAGAA pLKO.1 2056 CDS 100% 4.950 3.960 N Il31ra n/a
5 TRCN0000089338 CCAGGAAGAATGGAGTCCTTT pLKO.1 2582 3UTR 100% 4.950 3.465 N Il31ra n/a
6 TRCN0000106535 GCCTGGTCTACAAAGTGAGTT pLKO.1 4433 3UTR 100% 4.950 2.475 Y Gad2 n/a
7 TRCN0000166364 CACACACACACACACACACAA pLKO.1 3746 3UTR 100% 4.950 2.475 Y KAAG1 n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript XM_006517620.2, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

No results found.