Transcript: Mouse XM_006517956.3

PREDICTED: Mus musculus protein tyrosine phosphatase, receptor type, G (Ptprg), transcript variant X1, mRNA.

Source:
NCBI, updated 2016-06-22
Taxon:
Mus musculus (mouse)
Gene:
Ptprg (19270)
Length:
8409
CDS:
1..4242

Additional Resources:

NCBI RefSeq record:
XM_006517956.3
NBCI Gene record:
Ptprg (19270)

sgRNA constructs matching this transcript (CRISPRko, NGG PAM)

This list includes CRISPRko constructs with 100% (20mer + NGG) sequence match to the coding regions of this transcript.

No results found.

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Mouse XM_006517956.3, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Mouse Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000220434 CCGTCGTCTTTCAGTTAGAAA pLKO.1 2877 CDS 100% 5.625 7.875 N Ptprg n/a
2 TRCN0000314474 CCGTCGTCTTTCAGTTAGAAA pLKO_005 2877 CDS 100% 5.625 7.875 N Ptprg n/a
3 TRCN0000220436 CGACCACAACAAGCTCTGAAT pLKO.1 919 CDS 100% 4.950 6.930 N Ptprg n/a
4 TRCN0000314414 CGACCACAACAAGCTCTGAAT pLKO_005 919 CDS 100% 4.950 6.930 N Ptprg n/a
5 TRCN0000355985 TTACCTAGTTTGCACTATATG pLKO_005 4461 3UTR 100% 13.200 9.240 N PTPRG n/a
6 TRCN0000220435 CCTGTCAAACAGTTTGGTAAA pLKO.1 2389 CDS 100% 10.800 7.560 N Ptprg n/a
7 TRCN0000220437 GCCTCTCGAATGAAGAACAAA pLKO.1 3761 CDS 100% 5.625 3.938 N Ptprg n/a
8 TRCN0000314475 GCCTCTCGAATGAAGAACAAA pLKO_005 3761 CDS 100% 5.625 3.938 N Ptprg n/a
9 TRCN0000220433 CCGGGATGAAAGGAACAGATT pLKO.1 3497 CDS 100% 4.950 3.465 N Ptprg n/a
10 TRCN0000314415 CCGGGATGAAAGGAACAGATT pLKO_005 3497 CDS 100% 4.950 3.465 N Ptprg n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript XM_006517956.3, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

No results found.