Transcript: Mouse XM_006517994.2

PREDICTED: Mus musculus RIKEN cDNA 3830406C13 gene (3830406C13Rik), transcript variant X9, mRNA.

Source:
NCBI, updated 2016-06-22
Taxon:
Mus musculus (mouse)
Gene:
3830406C13Rik (218734)
Length:
2141
CDS:
136..567

Additional Resources:

NCBI RefSeq record:
XM_006517994.2
NBCI Gene record:
3830406C13Rik (218734)

sgRNA constructs matching this transcript (CRISPRko, NGG PAM)

This list includes CRISPRko constructs with 100% (20mer + NGG) sequence match to the coding regions of this transcript.

No results found.

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Mouse XM_006517994.2, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Mouse Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000195792 CAGCCTTCGATGCTTTCTCTT pLKO.1 364 CDS 100% 4.950 3.960 N 3830406C13Rik n/a
2 TRCN0000345725 CAGCCTTCGATGCTTTCTCTT pLKO_005 364 CDS 100% 4.950 3.960 N 3830406C13Rik n/a
3 TRCN0000184686 CCACTGAGACTGCTTCTAGAA pLKO.1 272 CDS 100% 4.950 3.465 N 3830406C13Rik n/a
4 TRCN0000345722 CCACTGAGACTGCTTCTAGAA pLKO_005 272 CDS 100% 4.950 3.465 N 3830406C13Rik n/a
5 TRCN0000195837 CCGACTCTTGAAGGACATAGA pLKO.1 300 CDS 100% 4.950 3.465 N 3830406C13Rik n/a
6 TRCN0000345723 CCGACTCTTGAAGGACATAGA pLKO_005 300 CDS 100% 4.950 3.465 N 3830406C13Rik n/a
7 TRCN0000415796 GACTCGTTACTGGGCATCAGT pLKO_005 387 CDS 100% 3.000 2.100 N C3orf14 n/a
8 TRCN0000196048 GAAGGACATAGATGCTGCAGA pLKO.1 309 CDS 100% 2.640 1.848 N 3830406C13Rik n/a
9 TRCN0000345724 GAAGGACATAGATGCTGCAGA pLKO_005 309 CDS 100% 2.640 1.848 N 3830406C13Rik n/a
10 TRCN0000432609 ACTGGGCATCAGTAGAAGAAT pLKO_005 395 CDS 100% 5.625 3.938 N C3orf14 n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript XM_006517994.2, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

No results found.