Transcript: Mouse XM_006518730.1

PREDICTED: Mus musculus protein tyrosine phosphatase, non-receptor type 20 (Ptpn20), transcript variant X4, mRNA.

Source:
NCBI, updated 2016-06-22
Taxon:
Mus musculus (mouse)
Gene:
Ptpn20 (19256)
Length:
2422
CDS:
74..832

Additional Resources:

NCBI RefSeq record:
XM_006518730.1
NBCI Gene record:
Ptpn20 (19256)

sgRNA constructs matching this transcript (CRISPRko, NGG PAM)

This list includes CRISPRko constructs with 100% (20mer + NGG) sequence match to the coding regions of this transcript.

No results found.

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Mouse XM_006518730.1, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Mouse Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000029895 CGGGATTGTTTGAACACGCTT pLKO.1 13 5UTR 100% 2.640 3.696 N Ptpn20 n/a
2 TRCN0000415300 GACTACATCAACGCTAGTTAT pLKO_005 188 CDS 100% 13.200 9.240 N Ptpn20 n/a
3 TRCN0000437664 TCCAGCTGGTAACCGAATAAC pLKO_005 1276 3UTR 100% 13.200 9.240 N Ptpn20 n/a
4 TRCN0000029894 CCTTGGTTAAAGGCTTTCAAT pLKO.1 1953 3UTR 100% 5.625 3.938 N Ptpn20 n/a
5 TRCN0000029898 CCATCGAGAAGAACTACTCTT pLKO.1 684 CDS 100% 4.950 3.465 N Ptpn20 n/a
6 TRCN0000029897 CGAGATATTCTTCCATATGAT pLKO.1 137 CDS 100% 0.000 0.000 N Ptpn20 n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript XM_006518730.1, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

No results found.