Transcript: Mouse XM_006518751.2

PREDICTED: Mus musculus solute carrier family 7 (cationic amino acid transporter, y+ system), member 7 (Slc7a7), transcript variant X4, mRNA.

Source:
NCBI, updated 2016-06-22
Taxon:
Mus musculus (mouse)
Gene:
Slc7a7 (20540)
Length:
1984
CDS:
108..1640

Additional Resources:

NCBI RefSeq record:
XM_006518751.2
NBCI Gene record:
Slc7a7 (20540)

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Mouse XM_006518751.2, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Mouse Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000079409 GCCATCTGTATGGTTCATGTT pLKO.1 1149 CDS 100% 4.950 6.930 N Slc7a7 n/a
2 TRCN0000324189 GCCATCTGTATGGTTCATGTT pLKO_005 1149 CDS 100% 4.950 6.930 N Slc7a7 n/a
3 TRCN0000079411 GCAGAAATGGACTTGGAAGAT pLKO.1 1584 CDS 100% 4.950 3.465 N Slc7a7 n/a
4 TRCN0000324191 GCAGAAATGGACTTGGAAGAT pLKO_005 1584 CDS 100% 4.950 3.465 N Slc7a7 n/a
5 TRCN0000079410 GCTAACTTTGAGAACTCCTTT pLKO.1 744 CDS 100% 4.950 3.465 N Slc7a7 n/a
6 TRCN0000079408 GCTACATGTTTCAGACTTCAT pLKO.1 1785 3UTR 100% 4.950 3.465 N Slc7a7 n/a
7 TRCN0000324188 GCTACATGTTTCAGACTTCAT pLKO_005 1785 3UTR 100% 4.950 3.465 N Slc7a7 n/a
8 TRCN0000079412 CGTCACCATCATCTACCTCTT pLKO.1 917 CDS 100% 4.050 2.835 N Slc7a7 n/a
9 TRCN0000324190 CGTCACCATCATCTACCTCTT pLKO_005 917 CDS 100% 4.050 2.835 N Slc7a7 n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript XM_006518751.2, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

Clone ID DNA Barcode Vector Sequenced %[?] Nuc. Match %[?] Prot. Match %[?] Epitope Tag Match Diffs[?] Addgene[?]
1 ccsbBroadEn_07351 pDONR223 99.4% 87.5% 90% None (many diffs) n/a
2 ccsbBroad304_07351 pLX_304 0% 87.5% 90% V5 (not translated due to prior stop codon) (many diffs) n/a
Download CSV