Transcript: Mouse XM_006518897.3

PREDICTED: Mus musculus cell cycle activator and apoptosis regulator 2 (Ccar2), transcript variant X2, mRNA.

Source:
NCBI, updated 2016-06-22
Taxon:
Mus musculus (mouse)
Gene:
Ccar2 (219158)
Length:
3725
CDS:
225..2990

Additional Resources:

NCBI RefSeq record:
XM_006518897.3
NBCI Gene record:
Ccar2 (219158)

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Mouse XM_006518897.3, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Mouse Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000342136 ATGACTATGACTCGAAGAAAC pLKO_005 811 CDS 100% 10.800 15.120 N Ccar2 n/a
2 TRCN0000352661 ACAAGGTCTAATGCCAATAAA pLKO_005 3334 3UTR 100% 15.000 10.500 N Ccar2 n/a
3 TRCN0000342194 GATGATGGAGAGGACGAATTT pLKO_005 2190 CDS 100% 13.200 9.240 N Ccar2 n/a
4 TRCN0000342192 CCAGCTTGCATGACTACTTTG pLKO_005 412 CDS 100% 10.800 7.560 N Ccar2 n/a
5 TRCN0000342137 GGTTCATCTCACTCCCTATAC pLKO_005 899 CDS 100% 10.800 7.560 N Ccar2 n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript XM_006518897.3, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

Clone ID DNA Barcode Vector Sequenced %[?] Nuc. Match %[?] Prot. Match %[?] Epitope Tag Match Diffs[?] Addgene[?]
1 ccsbBroadEn_12406 pDONR223 100% 33.7% 35% None (many diffs) n/a
2 ccsbBroad304_12406 pLX_304 0% 33.7% 35% V5 (many diffs) n/a
3 TRCN0000472079 GCCGTGTAGCGTAACTGGAACGGG pLX_317 30.2% 33.7% 35% V5 (many diffs) n/a
Download CSV