Transcript: Mouse XM_006518921.3

PREDICTED: Mus musculus integrin, beta-like 1 (Itgbl1), transcript variant X1, mRNA.

Source:
NCBI, updated 2016-06-22
Taxon:
Mus musculus (mouse)
Gene:
Itgbl1 (223272)
Length:
2421
CDS:
374..1717

Additional Resources:

NCBI RefSeq record:
XM_006518921.3
NBCI Gene record:
Itgbl1 (223272)

sgRNA constructs matching this transcript (CRISPRko, NGG PAM)

This list includes CRISPRko constructs with 100% (20mer + NGG) sequence match to the coding regions of this transcript.

No results found.

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Mouse XM_006518921.3, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Mouse Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000094077 CAGAGCTGTTTATGATCGATA pLKO.1 1060 CDS 100% 4.950 3.960 N Itgbl1 n/a
2 TRCN0000348885 AGAATTGTTCTCCCATAATTA pLKO_005 1888 3UTR 100% 15.000 10.500 N Itgbl1 n/a
3 TRCN0000145566 GCAGGTGTAAGTGTGATAATT pLKO.1 852 CDS 100% 15.000 10.500 N ITGBL1 n/a
4 TRCN0000094078 GTTCTGGAGAAGAGTGGTATA pLKO.1 1539 CDS 100% 10.800 7.560 N Itgbl1 n/a
5 TRCN0000352097 GTTCTGGAGAAGAGTGGTATA pLKO_005 1539 CDS 100% 10.800 7.560 N Itgbl1 n/a
6 TRCN0000094076 GCTGCTCCTCAAAGCTTCTTA pLKO.1 440 CDS 100% 5.625 3.938 N Itgbl1 n/a
7 TRCN0000352017 GCTGCTCCTCAAAGCTTCTTA pLKO_005 440 CDS 100% 5.625 3.938 N Itgbl1 n/a
8 TRCN0000094075 CGGAAGTGTAATATGACAGAA pLKO.1 1436 CDS 100% 4.950 3.465 N Itgbl1 n/a
9 TRCN0000352096 CGGAAGTGTAATATGACAGAA pLKO_005 1436 CDS 100% 4.950 3.465 N Itgbl1 n/a
10 TRCN0000094074 CCCATAATTAACATAGGTGTT pLKO.1 1899 3UTR 100% 4.050 2.835 N Itgbl1 n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript XM_006518921.3, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

No results found.