Transcript: Mouse XM_006518951.2

PREDICTED: Mus musculus oxoglutarate dehydrogenase-like (Ogdhl), transcript variant X1, mRNA.

Source:
NCBI, updated 2016-06-22
Taxon:
Mus musculus (mouse)
Gene:
Ogdhl (239017)
Length:
3728
CDS:
175..3207

Additional Resources:

NCBI RefSeq record:
XM_006518951.2
NBCI Gene record:
Ogdhl (239017)

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Mouse XM_006518951.2, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Mouse Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000251614 ACATAAGAACATGGGCTATTA pLKO_005 3009 CDS 100% 13.200 18.480 N Ogdhl n/a
2 TRCN0000251615 CCTGCTCTCAAGACCATTATC pLKO_005 997 CDS 100% 13.200 9.240 N Ogdhl n/a
3 TRCN0000251616 GATCTTCTGAAGGAGGTTATA pLKO_005 3211 3UTR 100% 13.200 9.240 N Ogdhl n/a
4 TRCN0000251613 GTGTACTATGACCTGGTAAAG pLKO_005 2854 CDS 100% 10.800 7.560 N Ogdhl n/a
5 TRCN0000251612 CTTGATCACAACCATTGATAA pLKO_005 627 CDS 100% 13.200 7.920 N Ogdhl n/a
6 TRCN0000426222 TGATCACAACCATTGATAAAC pLKO_005 629 CDS 100% 13.200 18.480 N OGDHL n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript XM_006518951.2, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

Clone ID DNA Barcode Vector Sequenced %[?] Nuc. Match %[?] Prot. Match %[?] Epitope Tag Match Diffs[?] Addgene[?]
1 ccsbBroadEn_08578 pDONR223 100% 87.5% 92.9% None (many diffs) n/a
2 ccsbBroad304_08578 pLX_304 0% 87.5% 92.9% V5 (many diffs) n/a
3 TRCN0000473460 TGCAGGAATTATCTCCTTCGTCTG pLX_317 17.5% 87.5% 92.9% V5 (many diffs) n/a
Download CSV