Transcript: Mouse XM_006519115.3

PREDICTED: Mus musculus fibronectin type III domain containing 3A (Fndc3a), transcript variant X1, mRNA.

Source:
NCBI, updated 2016-06-22
Taxon:
Mus musculus (mouse)
Gene:
Fndc3a (319448)
Length:
5981
CDS:
166..3762

Additional Resources:

NCBI RefSeq record:
XM_006519115.3
NBCI Gene record:
Fndc3a (319448)

sgRNA constructs matching this transcript (CRISPRko, NGG PAM)

This list includes CRISPRko constructs with 100% (20mer + NGG) sequence match to the coding regions of this transcript.

No results found.

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Mouse XM_006519115.3, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Mouse Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000120551 CGGAAAGCTTTACGACCTTAA pLKO.1 1247 CDS 100% 10.800 15.120 N Fndc3a n/a
2 TRCN0000339997 CGGAAAGCTTTACGACCTTAA pLKO_005 1247 CDS 100% 10.800 15.120 N Fndc3a n/a
3 TRCN0000120549 CCCACAGGTTATCGAAGACAA pLKO.1 411 CDS 100% 4.950 6.930 N Fndc3a n/a
4 TRCN0000339925 CCCACAGGTTATCGAAGACAA pLKO_005 411 CDS 100% 4.950 6.930 N Fndc3a n/a
5 TRCN0000160817 CCAGTAAACTTCAAGCTGCTT pLKO.1 4873 3UTR 100% 2.640 2.112 N FNDC3A n/a
6 TRCN0000160207 CCTAGTGACAATGGTTCTAAA pLKO.1 1345 CDS 100% 13.200 9.240 N FNDC3A n/a
7 TRCN0000339999 GCGACATGGCAACGCAGTATA pLKO_005 596 CDS 100% 13.200 9.240 N Fndc3a n/a
8 TRCN0000120550 CCTTCAGTTAAAGGGAAGATA pLKO.1 1873 CDS 100% 5.625 3.938 N Fndc3a n/a
9 TRCN0000339998 CCTTCAGTTAAAGGGAAGATA pLKO_005 1873 CDS 100% 5.625 3.938 N Fndc3a n/a
10 TRCN0000120547 GCCGTCAGAATTTCTAATCAA pLKO.1 4801 3UTR 100% 5.625 3.938 N Fndc3a n/a
11 TRCN0000120548 CCTGCCATTGTGACTTGTCTT pLKO.1 2722 CDS 100% 4.950 3.465 N Fndc3a n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript XM_006519115.3, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

No results found.