Transcript: Mouse XM_006519229.2

PREDICTED: Mus musculus sacsin (Sacs), transcript variant X4, mRNA.

Source:
NCBI, updated 2016-06-22
Taxon:
Mus musculus (mouse)
Gene:
Sacs (50720)
Length:
14499
CDS:
119..13255

Additional Resources:

NCBI RefSeq record:
XM_006519229.2
NBCI Gene record:
Sacs (50720)

sgRNA constructs matching this transcript (CRISPRko, NGG PAM)

This list includes CRISPRko constructs with 100% (20mer + NGG) sequence match to the coding regions of this transcript.

No results found.

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Mouse XM_006519229.2, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Mouse Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000367332 GAACGGCTATAAGTAACTATT pLKO_005 537 CDS 100% 13.200 18.480 N Sacs n/a
2 TRCN0000098958 CCACAAGTCATAAATCTGAAA pLKO.1 12729 CDS 100% 4.950 6.930 N Sacs n/a
3 TRCN0000098955 CGGACTTATATTGCTTAGTAA pLKO.1 8427 CDS 100% 5.625 4.500 N Sacs n/a
4 TRCN0000303372 AGTTGACATCAGATCATATTT pLKO_005 3489 CDS 100% 15.000 10.500 N SACS n/a
5 TRCN0000367331 CCTGTGTAACATATCATATAA pLKO_005 585 CDS 100% 15.000 10.500 N Sacs n/a
6 TRCN0000098957 CCTCTGTAATTGACAGTGTTA pLKO.1 7857 CDS 100% 4.950 3.465 N Sacs n/a
7 TRCN0000098956 GCCTTATTGATGAGAAGCTAA pLKO.1 6081 CDS 100% 4.950 3.465 N Sacs n/a
8 TRCN0000098959 CCCAACCAGTTCAAACCATTT pLKO.1 4355 CDS 100% 10.800 6.480 N Sacs n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript XM_006519229.2, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

No results found.