Transcript: Mouse XM_006519450.3

PREDICTED: Mus musculus RIKEN cDNA 3632451O06 gene (3632451O06Rik), transcript variant X1, mRNA.

Source:
NCBI, updated 2016-06-22
Taxon:
Mus musculus (mouse)
Gene:
3632451O06Rik (67419)
Length:
3141
CDS:
133..2457

Additional Resources:

NCBI RefSeq record:
XM_006519450.3
NBCI Gene record:
3632451O06Rik (67419)

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Mouse XM_006519450.3, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Mouse Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000216424 GATATTCCGTGAGATTATTAT pLKO.1 2479 3UTR 100% 15.000 21.000 N 3632451O06Rik n/a
2 TRCN0000174485 CGATAGACAAATTCTAAGGAA pLKO.1 2854 3UTR 100% 3.000 2.400 N 3632451O06Rik n/a
3 TRCN0000175223 CCAGCCTCTTGTTTCTTATTA pLKO.1 3041 3UTR 100% 15.000 10.500 N 3632451O06Rik n/a
4 TRCN0000122652 GAGTGGGAACAGCAGAATCAA pLKO.1 2197 CDS 100% 5.625 3.938 N ARMH4 n/a
5 TRCN0000174724 GCACAAGAATATGCAGAGAAA pLKO.1 301 CDS 100% 4.950 3.465 N 3632451O06Rik n/a
6 TRCN0000174954 GCTGCAATTTAGAAACTCATA pLKO.1 2714 3UTR 100% 4.950 3.465 N 3632451O06Rik n/a
7 TRCN0000176164 GTCAACTCCTTCAACCTGTTT pLKO.1 160 CDS 100% 4.950 3.465 N 3632451O06Rik n/a
8 TRCN0000174457 CAACTTGAATCTGAAGAGGTA pLKO.1 1945 CDS 100% 2.640 1.848 N 3632451O06Rik n/a
9 TRCN0000176163 GAGACAATGCAGAGACTCAAA pLKO.1 1142 CDS 100% 4.950 2.970 N 3632451O06Rik n/a
10 TRCN0000144995 GAAGAGGATGAAGAAGATGAA pLKO.1 1981 CDS 100% 4.950 2.475 Y ARMH4 n/a
11 TRCN0000143538 GATGAGGATGAAGAGGATGAA pLKO.1 1972 CDS 100% 4.950 2.475 Y ARMH4 n/a
12 TRCN0000144930 GAAGAAGAAGATGAGGAAGAA pLKO.1 2008 CDS 100% 4.950 2.475 Y PTMS n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript XM_006519450.3, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

No results found.