Transcript: Mouse XM_006519457.3

PREDICTED: Mus musculus leucine rich repeat containing 18 (Lrrc18), transcript variant X1, mRNA.

Source:
NCBI, updated 2016-06-22
Taxon:
Mus musculus (mouse)
Gene:
Lrrc18 (67580)
Length:
2516
CDS:
277..1065

Additional Resources:

NCBI RefSeq record:
XM_006519457.3
NBCI Gene record:
Lrrc18 (67580)

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Mouse XM_006519457.3, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Mouse Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000251949 GCTAGATCTTAGCCGGAATAT pLKO_005 438 CDS 100% 13.200 18.480 N Lrrc18 n/a
2 TRCN0000251951 TATGACTCTACCGTCACTTTA pLKO_005 2222 3UTR 100% 13.200 18.480 N Lrrc18 n/a
3 TRCN0000251950 ACCGTGAATCTGGGCCTTAAC pLKO_005 649 CDS 100% 10.800 8.640 N Lrrc18 n/a
4 TRCN0000183666 CGGTGTTCTAACATCTTAATA pLKO.1 1625 3UTR 100% 15.000 10.500 N Lrrc18 n/a
5 TRCN0000251953 GACCTGCACAGTAACTATATT pLKO_005 511 CDS 100% 15.000 10.500 N Lrrc18 n/a
6 TRCN0000216206 CTGAAGAAGCTCAACATAAAG pLKO.1 781 CDS 100% 13.200 9.240 N Lrrc18 n/a
7 TRCN0000251952 CACCTTCTAGAGTAGCTTATG pLKO_005 1056 CDS 100% 10.800 7.560 N Lrrc18 n/a
8 TRCN0000217798 CTTCCCAAATGCAGATGAATC pLKO.1 810 CDS 100% 10.800 7.560 N Lrrc18 n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript XM_006519457.3, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

No results found.