Transcript: Mouse XM_006519459.1

PREDICTED: Mus musculus sterile alpha motif domain containing 8 (Samd8), transcript variant X1, mRNA.

Source:
NCBI, updated 2016-06-22
Taxon:
Mus musculus (mouse)
Gene:
Samd8 (67630)
Length:
7048
CDS:
267..1565

Additional Resources:

NCBI RefSeq record:
XM_006519459.1
NBCI Gene record:
Samd8 (67630)

sgRNA constructs matching this transcript (CRISPRko, NGG PAM)

This list includes CRISPRko constructs with 100% (20mer + NGG) sequence match to the coding regions of this transcript.

No results found.

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Mouse XM_006519459.1, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Mouse Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000250080 CTTAGGGCCAAGGGATATATT pLKO_005 3236 3UTR 100% 15.000 21.000 N Samd8 n/a
2 TRCN0000177649 CCACACAGTTGTTCTAACCAT pLKO.1 1217 CDS 100% 3.000 2.400 N Samd8 n/a
3 TRCN0000232592 TGGCTGCCCATGAACATTATT pLKO_005 1333 CDS 100% 15.000 10.500 N SAMD8 n/a
4 TRCN0000250078 ACGTCTTTCATTATGGTTATT pLKO_005 813 CDS 100% 13.200 9.240 N Samd8 n/a
5 TRCN0000217434 GTGAGTGTCTTACTGGTAAAT pLKO.1 1999 3UTR 100% 13.200 9.240 N Samd8 n/a
6 TRCN0000250079 TAGTCTGATGGGCACTGTATT pLKO_005 1016 CDS 100% 13.200 9.240 N Samd8 n/a
7 TRCN0000250081 AGAGTAGGAGAGCGAGGATTT pLKO_005 1438 CDS 100% 10.800 7.560 N Samd8 n/a
8 TRCN0000257972 GTTAATGGCACAGTACCTAAT pLKO_005 1491 CDS 100% 10.800 7.560 N Samd8 n/a
9 TRCN0000198346 GAGGATTTGGTTCCCTATGTT pLKO.1 1451 CDS 100% 5.625 3.938 N Samd8 n/a
10 TRCN0000151707 CCTCTTTGGAATCTTCTTCAT pLKO.1 1310 CDS 100% 4.950 2.970 N SAMD8 n/a
11 TRCN0000057398 CCTCCCAAGTTGCTGGGATTA pLKO.1 6015 3UTR 100% 1.080 0.648 N KLRC3 n/a
12 TRCN0000054408 ACGCCTTTAATCCCAGCACTT pLKO.1 5080 3UTR 100% 4.050 2.025 Y Mtif2 n/a
13 TRCN0000153138 GCTGGAATTTCTTGCACACTT pLKO.1 1273 CDS 100% 4.950 3.960 N SAMD8 n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript XM_006519459.1, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

No results found.