Transcript: Mouse XM_006519637.2

PREDICTED: Mus musculus RIKEN cDNA 4930503E14 gene (4930503E14Rik), transcript variant X1, mRNA.

Source:
NCBI, updated 2016-06-22
Taxon:
Mus musculus (mouse)
Gene:
4930503E14Rik (74954)
Length:
1430
CDS:
209..637

Additional Resources:

NCBI RefSeq record:
XM_006519637.2
NBCI Gene record:
4930503E14Rik (74954)

sgRNA constructs matching this transcript (CRISPRko, NGG PAM)

This list includes CRISPRko constructs with 100% (20mer + NGG) sequence match to the coding regions of this transcript.

No results found.

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Mouse XM_006519637.2, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Mouse Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000176842 GCTGTAAGTCTTTGCTATAAA pLKO.1 1028 3UTR 100% 15.000 10.500 N 4930503E14Rik n/a
2 TRCN0000197904 GTTGGAATGAATAGCCCTTAA pLKO.1 682 3UTR 100% 10.800 7.560 N 4930503E14Rik n/a
3 TRCN0000177924 CGTTGGAATGAATAGCCCTTA pLKO.1 681 3UTR 100% 4.050 2.835 N 4930503E14Rik n/a
4 TRCN0000181507 GCTTAGTCTTGGGTGTCCTTA pLKO.1 901 3UTR 100% 4.950 2.970 N 4930503E14Rik n/a
5 TRCN0000176973 GAATGAAATCATTCTGGGAAA pLKO.1 207 5UTR 100% 0.405 0.243 N 4930503E14Rik n/a
6 TRCN0000197855 GATTCCTACAGGTGTGAAATA pLKO.1 518 CDS 100% 13.200 6.600 Y 4930503E14Rik n/a
7 TRCN0000270589 TTGCAACATCACTAATCATAT pLKO_005 262 CDS 100% 13.200 6.600 Y Gm7247 n/a
8 TRCN0000201017 CCCAGTAATCATGGCTATCAT pLKO.1 630 CDS 100% 5.625 2.813 Y Gm5622 n/a
9 TRCN0000198703 CAAGACCAAGGCAGAAGGAAT pLKO.1 159 5UTR 100% 4.950 2.475 Y 4930503E14Rik n/a
10 TRCN0000192160 CACAACATGAGAAGACAATGT pLKO.1 426 CDS 100% 4.950 2.475 Y Gm3696 n/a
11 TRCN0000176722 CATAGAAGATAAGGATTCCTA pLKO.1 505 CDS 100% 3.000 1.500 Y 4930503E14Rik n/a
12 TRCN0000176783 CGAAGCAAATATTTCATCTCA pLKO.1 607 CDS 100% 3.000 1.500 Y 4930503E14Rik n/a
13 TRCN0000023063 GCAGTCAATAAGTGATACCAT pLKO.1 466 CDS 100% 3.000 1.500 Y LOC382881 n/a
14 TRCN0000200690 GCAACATCACTAATCATATGA pLKO.1 264 CDS 100% 0.000 0.000 Y 1700024B05Rik n/a
15 TRCN0000177036 GAAGACAATGTTGGATATGAA pLKO.1 436 CDS 100% 5.625 2.813 Y Gm10128 n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript XM_006519637.2, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

No results found.