Transcript: Mouse XM_006519643.3

PREDICTED: Mus musculus SLIT and NTRK-like family, member 5 (Slitrk5), transcript variant X3, mRNA.

Source:
NCBI, updated 2016-06-22
Taxon:
Mus musculus (mouse)
Gene:
Slitrk5 (75409)
Length:
4971
CDS:
773..3646

Additional Resources:

NCBI RefSeq record:
XM_006519643.3
NBCI Gene record:
Slitrk5 (75409)

sgRNA constructs matching this transcript (CRISPRko, NGG PAM)

This list includes CRISPRko constructs with 100% (20mer + NGG) sequence match to the coding regions of this transcript.

No results found.

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Mouse XM_006519643.3, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Mouse Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000364200 TGCAGAAACCATCGATTATTA pLKO_005 883 CDS 100% 15.000 21.000 N Slitrk5 n/a
2 TRCN0000079178 CGCGGGAAACATTTGTGTAAA pLKO.1 3827 3UTR 100% 13.200 18.480 N Slitrk5 n/a
3 TRCN0000364198 GAATACCTGCAGGTCGATTAC pLKO_005 1238 CDS 100% 10.800 15.120 N Slitrk5 n/a
4 TRCN0000079181 GCTGCTATTCTTGAATAACAA pLKO.1 2296 CDS 100% 5.625 4.500 N Slitrk5 n/a
5 TRCN0000079179 CCTCCCAGAATACCCTAAATT pLKO.1 3388 CDS 100% 15.000 10.500 N Slitrk5 n/a
6 TRCN0000364199 CCTCCTGCACCTGGGTAATAA pLKO_005 2080 CDS 100% 15.000 10.500 N Slitrk5 n/a
7 TRCN0000303815 GTGCAGAAACCATCGATTATT pLKO_005 882 CDS 100% 15.000 10.500 N SLITRK5 n/a
8 TRCN0000079180 GCAGGTCGATTACAATTACAT pLKO.1 1246 CDS 100% 5.625 3.938 N Slitrk5 n/a
9 TRCN0000079182 CCCAATCTATCACCTCTTGTT pLKO.1 1015 CDS 100% 4.950 2.970 N Slitrk5 n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript XM_006519643.3, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

No results found.