Transcript: Mouse XM_006520021.3

PREDICTED: Mus musculus drosha, ribonuclease type III (Drosha), transcript variant X1, mRNA.

Source:
NCBI, updated 2016-06-22
Taxon:
Mus musculus (mouse)
Gene:
Drosha (14000)
Length:
4705
CDS:
357..4538

Additional Resources:

NCBI RefSeq record:
XM_006520021.3
NBCI Gene record:
Drosha (14000)

sgRNA constructs matching this transcript (CRISPRko, NGG PAM)

This list includes CRISPRko constructs with 100% (20mer + NGG) sequence match to the coding regions of this transcript.

No results found.

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Mouse XM_006520021.3, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Mouse Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000119520 CGAAGAGATGATGCCTGAGAA pLKO.1 2309 CDS 100% 4.950 3.960 N Drosha n/a
2 TRCN0000119518 CCTGGACAAGTTGATAGGATA pLKO.1 3047 CDS 100% 4.950 3.465 N Drosha n/a
3 TRCN0000119521 CTTCGAGAAGTCTGGCTCAAT pLKO.1 3633 CDS 100% 4.950 3.465 N Drosha n/a
4 TRCN0000119517 CCGTGATTTGTATGACAAATT pLKO.1 1736 CDS 100% 1.320 0.924 N Drosha n/a
5 TRCN0000119519 CCTGGAATATGTCCACACTTT pLKO.1 4112 CDS 100% 4.950 2.970 N Drosha n/a
6 TRCN0000381987 AGAGAAAGAGGCAGAGGAGAA pLKO_005 1577 CDS 100% 4.050 2.025 Y Cplx2 n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript XM_006520021.3, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

No results found.