Transcript: Mouse XM_006520065.3

PREDICTED: Mus musculus grainyhead-like 2 (Drosophila) (Grhl2), transcript variant X5, mRNA.

Source:
NCBI, updated 2016-06-22
Taxon:
Mus musculus (mouse)
Gene:
Grhl2 (252973)
Length:
2004
CDS:
358..1713

Additional Resources:

NCBI RefSeq record:
XM_006520065.3
NBCI Gene record:
Grhl2 (252973)

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Mouse XM_006520065.3, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Mouse Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000084223 CGGAGAAATTTCGGAGTACTT pLKO.1 1031 CDS 100% 4.950 6.930 N Grhl2 n/a
2 TRCN0000084226 CGCATACAATGCTGTTTCCTT pLKO.1 1407 CDS 100% 3.000 2.400 N Grhl2 n/a
3 TRCN0000310950 CCAGTGAAGCCCAGATCAATT pLKO_005 656 CDS 100% 13.200 9.240 N Grhl2 n/a
4 TRCN0000084225 CCTCAACAAAGGACAATTCTA pLKO.1 1164 CDS 100% 5.625 3.938 N Grhl2 n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript XM_006520065.3, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

Clone ID DNA Barcode Vector Sequenced %[?] Nuc. Match %[?] Prot. Match %[?] Epitope Tag Match Diffs[?] Addgene[?]
1 ccsbBroadEn_04157 pDONR223 100% 62.7% 64.2% None (many diffs) n/a
2 ccsbBroad304_04157 pLX_304 0% 62.7% 64.2% V5 (many diffs) n/a
Download CSV