Transcript: Mouse XM_006520079.3

PREDICTED: Mus musculus sperm associated antigen 1 (Spag1), transcript variant X9, mRNA.

Source:
NCBI, updated 2016-06-22
Taxon:
Mus musculus (mouse)
Gene:
Spag1 (26942)
Length:
3793
CDS:
1064..3070

Additional Resources:

NCBI RefSeq record:
XM_006520079.3
NBCI Gene record:
Spag1 (26942)

sgRNA constructs matching this transcript (CRISPRko, NGG PAM)

This list includes CRISPRko constructs with 100% (20mer + NGG) sequence match to the coding regions of this transcript.

No results found.

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Mouse XM_006520079.3, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Mouse Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000353302 CAATCGAGCTCAGGCCGAAAT pLKO_005 1114 CDS 100% 10.800 15.120 N Spag1 n/a
2 TRCN0000353301 GACGATGCTGACACTAATTAA pLKO_005 2938 CDS 100% 15.000 12.000 N Spag1 n/a
3 TRCN0000353369 GATGCAGTTGCATGGGTAAAG pLKO_005 3106 3UTR 100% 10.800 8.640 N Spag1 n/a
4 TRCN0000336087 GACGTCTCCAAGCCTACTAAT pLKO_005 2684 CDS 100% 13.200 9.240 N Spag1 n/a
5 TRCN0000336086 GCTAGATCCCGGAAACGTAAA pLKO_005 1186 CDS 100% 10.800 7.560 N Spag1 n/a
6 TRCN0000114260 CCTGCCACTGTTGCTAAGTAA pLKO.1 2797 CDS 100% 5.625 3.938 N Spag1 n/a
7 TRCN0000114257 GCCACTACATATAAACATCAA pLKO.1 1223 CDS 100% 4.950 3.465 N Spag1 n/a
8 TRCN0000114258 GCCTACTAATGCCTATGAGTT pLKO.1 2695 CDS 100% 4.950 3.465 N Spag1 n/a
9 TRCN0000114259 GCACGAATCTTAACAGAGCTA pLKO.1 2012 CDS 100% 2.640 1.848 N Spag1 n/a
10 TRCN0000155149 GCCTATAACAATCGAGCTCAA pLKO.1 1106 CDS 100% 4.050 5.670 N SPAG1 n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript XM_006520079.3, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

No results found.