Transcript: Mouse XM_006520095.3

PREDICTED: Mus musculus cadherin 18 (Cdh18), transcript variant X3, mRNA.

Source:
NCBI, updated 2016-06-22
Taxon:
Mus musculus (mouse)
Gene:
Cdh18 (320865)
Length:
2944
CDS:
558..2930

Additional Resources:

NCBI RefSeq record:
XM_006520095.3
NBCI Gene record:
Cdh18 (320865)

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Mouse XM_006520095.3, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Mouse Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000258153 GCCAATACTGGAACCATTAAG pLKO_005 1860 CDS 100% 13.200 10.560 N Cdh18 n/a
2 TRCN0000251227 CCTGCAAGGACAACCTTATTT pLKO_005 1160 CDS 100% 15.000 10.500 N Cdh18 n/a
3 TRCN0000267403 GCCATGTCTCCGTGGGTATTA pLKO_005 1966 CDS 100% 13.200 9.240 N Cdh18 n/a
4 TRCN0000251226 GTGTATTATCTGCCCATTATG pLKO_005 2244 CDS 100% 13.200 9.240 N Cdh18 n/a
5 TRCN0000258160 GCTATTGACAGACGGACAAAC pLKO_005 945 CDS 100% 10.800 7.560 N Cdh18 n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript XM_006520095.3, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

Clone ID DNA Barcode Vector Sequenced %[?] Nuc. Match %[?] Prot. Match %[?] Epitope Tag Match Diffs[?] Addgene[?]
1 ccsbBroadEn_05978 pDONR223 100% 89% 95.5% None (many diffs) n/a
2 ccsbBroad304_05978 pLX_304 0% 89% 95.5% V5 (many diffs) n/a
Download CSV