Transcript: Mouse XM_006520282.2

PREDICTED: Mus musculus cytochrome b5 reductase 3 (Cyb5r3), transcript variant X1, mRNA.

Source:
NCBI, updated 2016-06-22
Taxon:
Mus musculus (mouse)
Gene:
Cyb5r3 (109754)
Length:
2031
CDS:
14..976

Additional Resources:

NCBI RefSeq record:
XM_006520282.2
NBCI Gene record:
Cyb5r3 (109754)

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Mouse XM_006520282.2, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Mouse Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000236408 AGGACACCCATCCCAAGTTTC pLKO_005 414 CDS 100% 10.800 7.560 N CYB5R3 n/a
2 TRCN0000126228 GTGAAGTCTGTAGGCATGATT pLKO.1 584 CDS 100% 5.625 3.938 N Cyb5r3 n/a
3 TRCN0000126226 CCTTCCTATTGGCCAACACAT pLKO.1 286 CDS 100% 4.950 3.465 N Cyb5r3 n/a
4 TRCN0000126225 CGAACATTCTGCTCGCTTCAA pLKO.1 751 CDS 100% 4.950 3.465 N Cyb5r3 n/a
5 TRCN0000126227 GAGGAACTGAGGAACGAACAT pLKO.1 737 CDS 100% 4.950 3.465 N Cyb5r3 n/a
6 TRCN0000126224 CAACAGAGTTTGGTAGACCTT pLKO.1 1807 3UTR 100% 2.640 1.848 N Cyb5r3 n/a
7 TRCN0000038978 GTTTACTTCAAGGACACCCAT pLKO.1 404 CDS 100% 2.640 1.848 N CYB5R3 n/a
8 TRCN0000166364 CACACACACACACACACACAA pLKO.1 1276 3UTR 100% 4.950 2.475 Y KAAG1 n/a
9 TRCN0000138947 GAGAGAGAGGAGAGAGAGAAA pLKO.1 1340 3UTR 100% 4.950 2.475 Y TVP23C n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript XM_006520282.2, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

No results found.