Transcript: Mouse XM_006520381.1

PREDICTED: Mus musculus cadherin, EGF LAG seven-pass G-type receptor 1 (Celsr1), transcript variant X3, mRNA.

Source:
NCBI, updated 2016-06-22
Taxon:
Mus musculus (mouse)
Gene:
Celsr1 (12614)
Length:
9639
CDS:
448..9546

Additional Resources:

NCBI RefSeq record:
XM_006520381.1
NBCI Gene record:
Celsr1 (12614)

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Mouse XM_006520381.1, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Mouse Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000027386 CGCAGGTCTTTATCAACGTTA pLKO.1 2810 CDS 100% 4.950 6.930 N Celsr1 n/a
2 TRCN0000027389 CGCGTGACCATCATTACAGAT pLKO.1 4072 CDS 100% 4.950 6.930 N Celsr1 n/a
3 TRCN0000378227 GCCAAAGAAAGCACCATTATT pLKO_005 8405 CDS 100% 15.000 10.500 N CELSR1 n/a
4 TRCN0000027366 GCTGCGTTTATTGCCAACAAT pLKO.1 5392 CDS 100% 5.625 3.938 N Celsr1 n/a
5 TRCN0000027368 CCAGATTCTCAACAGCTACAT pLKO.1 5715 CDS 100% 4.950 3.465 N Celsr1 n/a
6 TRCN0000027349 CCGTAACTGTCAGTGACACTA pLKO.1 1511 CDS 100% 4.950 3.465 N Celsr1 n/a
7 TRCN0000008240 CCTGCCAAAGAAAGCACCATT pLKO.1 8402 CDS 100% 4.950 3.465 N CELSR1 n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript XM_006520381.1, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

No results found.