Transcript: Mouse XM_006520405.2

PREDICTED: Mus musculus diacylglycerol O-acyltransferase 1 (Dgat1), transcript variant X1, mRNA.

Source:
NCBI, updated 2016-06-22
Taxon:
Mus musculus (mouse)
Gene:
Dgat1 (13350)
Length:
2224
CDS:
702..2003

Additional Resources:

NCBI RefSeq record:
XM_006520405.2
NBCI Gene record:
Dgat1 (13350)

sgRNA constructs matching this transcript (CRISPRko, NGG PAM)

This list includes CRISPRko constructs with 100% (20mer + NGG) sequence match to the coding regions of this transcript.

No results found.

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Mouse XM_006520405.2, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Mouse Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000124793 CGGATCATTGAGCGTCTCTTA pLKO.1 1491 CDS 100% 4.950 6.930 N Dgat1 n/a
2 TRCN0000354252 CGGATCATTGAGCGTCTCTTA pLKO_005 1491 CDS 100% 4.950 6.930 N Dgat1 n/a
3 TRCN0000124789 CCTGAGTAATGCAAGGTTATT pLKO.1 824 CDS 100% 13.200 10.560 N Dgat1 n/a
4 TRCN0000327195 CCTGAGTAATGCAAGGTTATT pLKO_005 824 CDS 100% 13.200 10.560 N Dgat1 n/a
5 TRCN0000124791 GCTGAGTCTGTCACCTACTTT pLKO.1 1638 CDS 100% 5.625 3.938 N Dgat1 n/a
6 TRCN0000327194 GCTGAGTCTGTCACCTACTTT pLKO_005 1638 CDS 100% 5.625 3.938 N Dgat1 n/a
7 TRCN0000124792 GCCCTTCAAGGATATGGACTA pLKO.1 1466 CDS 100% 4.050 2.835 N Dgat1 n/a
8 TRCN0000327268 GCCCTTCAAGGATATGGACTA pLKO_005 1466 CDS 100% 4.050 2.835 N Dgat1 n/a
9 TRCN0000124790 GCGTGATTATTGCATCCAATA pLKO.1 937 CDS 100% 1.080 0.756 N Dgat1 n/a
10 TRCN0000036149 CGACTACTACGTGCTCAACTA pLKO.1 1961 CDS 100% 4.950 2.970 N DGAT1 n/a
11 TRCN0000236203 ACTACTACGTGCTCAACTATG pLKO_005 1963 CDS 100% 10.800 7.560 N DGAT1 n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript XM_006520405.2, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

No results found.