Transcript: Mouse XM_006520442.3

PREDICTED: Mus musculus X-ray repair complementing defective repair in Chinese hamster cells 6 (Xrcc6), transcript variant X2, mRNA.

Source:
NCBI, updated 2016-06-22
Taxon:
Mus musculus (mouse)
Gene:
Xrcc6 (14375)
Length:
2482
CDS:
489..2315

Additional Resources:

NCBI RefSeq record:
XM_006520442.3
NBCI Gene record:
Xrcc6 (14375)

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Mouse XM_006520442.3, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Mouse Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000321228 TGCTAGAGCTCGACCAGTTTA pLKO_005 829 CDS 100% 13.200 18.480 N Xrcc6 n/a
2 TRCN0000012222 GCAGATGAGTTTAAAGAACTT pLKO.1 2046 CDS 100% 4.950 3.960 N Xrcc6 n/a
3 TRCN0000012221 GCTCACTGTACCTACACTGAA pLKO.1 2207 CDS 100% 4.950 3.960 N Xrcc6 n/a
4 TRCN0000321226 GCTCACTGTACCTACACTGAA pLKO_005 2207 CDS 100% 4.950 3.960 N Xrcc6 n/a
5 TRCN0000012220 CCGACACAGGTGGAGAATATA pLKO.1 553 CDS 100% 15.000 10.500 N Xrcc6 n/a
6 TRCN0000321294 CCGACACAGGTGGAGAATATA pLKO_005 553 CDS 100% 15.000 10.500 N Xrcc6 n/a
7 TRCN0000012219 CGTCAGATTGTGCTGGAGAAA pLKO.1 1455 CDS 100% 4.950 3.465 N Xrcc6 n/a
8 TRCN0000012218 AGCTCAGAAGCCCAGCCACTT pLKO.1 2320 3UTR 100% 1.350 0.945 N Xrcc6 n/a
9 TRCN0000350563 AGCTCAGAAGCCCAGCCACTT pLKO_005 2320 3UTR 100% 1.350 0.945 N Xrcc6 n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript XM_006520442.3, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

No results found.