Transcript: Mouse XM_006520678.3

PREDICTED: Mus musculus leucine rich repeat and fibronectin type III, extracellular 2 (Elfn2), transcript variant X3, mRNA.

Source:
NCBI, updated 2016-06-22
Taxon:
Mus musculus (mouse)
Gene:
Elfn2 (207393)
Length:
7879
CDS:
865..3336

Additional Resources:

NCBI RefSeq record:
XM_006520678.3
NBCI Gene record:
Elfn2 (207393)

sgRNA constructs matching this transcript (CRISPRko, NGG PAM)

This list includes CRISPRko constructs with 100% (20mer + NGG) sequence match to the coding regions of this transcript.

No results found.

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Mouse XM_006520678.3, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Mouse Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000109561 CGTCAATGTTAAGAAGACTAT pLKO.1 2157 CDS 100% 4.950 6.930 N Elfn2 n/a
2 TRCN0000109564 GCTACCAAAGGCAACTATATT pLKO.1 2353 CDS 100% 15.000 12.000 N Elfn2 n/a
3 TRCN0000153005 GACAAGGTCAACCAGATCATT pLKO.1 2488 CDS 100% 5.625 3.938 N ELFN2 n/a
4 TRCN0000109563 CCACCCTTACAGCAAGATGTA pLKO.1 1812 CDS 100% 4.950 3.465 N Elfn2 n/a
5 TRCN0000109562 CGACTCCAAGTACATTGAGAA pLKO.1 2850 CDS 100% 4.950 3.465 N Elfn2 n/a
6 TRCN0000109560 CCTCTTGTTCAGAGAGGCTAT pLKO.1 3739 3UTR 100% 0.405 0.284 N Elfn2 n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript XM_006520678.3, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

No results found.