Transcript: Mouse XM_006520976.3

PREDICTED: Mus musculus disco interacting protein 2 homolog B (Dip2b), transcript variant X3, mRNA.

Source:
NCBI, updated 2016-06-22
Taxon:
Mus musculus (mouse)
Gene:
Dip2b (239667)
Length:
8936
CDS:
171..4892

Additional Resources:

NCBI RefSeq record:
XM_006520976.3
NBCI Gene record:
Dip2b (239667)

sgRNA constructs matching this transcript (CRISPRko, NGG PAM)

This list includes CRISPRko constructs with 100% (20mer + NGG) sequence match to the coding regions of this transcript.

No results found.

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Mouse XM_006520976.3, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Mouse Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000098719 CGTGTGTCCTTACCACTCAAA pLKO.1 3463 CDS 100% 4.950 6.930 N Dip2b n/a
2 TRCN0000098715 GCCAGCTAACACGTTACCAAA pLKO.1 2858 CDS 100% 4.950 6.930 N Dip2b n/a
3 TRCN0000098718 CCCTATCTATGTGGCTTACAA pLKO.1 4865 CDS 100% 5.625 3.938 N Dip2b n/a
4 TRCN0000098716 CGTATCTTGATTTCAGCGTTT pLKO.1 3622 CDS 100% 4.050 2.835 N Dip2b n/a
5 TRCN0000098717 GCTTTCTGAATCTGGAAAGAT pLKO.1 4244 CDS 100% 0.563 0.394 N Dip2b n/a
6 TRCN0000121660 GAAGAGCATTACCTCATCGTT pLKO.1 4743 CDS 100% 3.000 2.100 N DIP2B n/a
7 TRCN0000121734 CCATTCTCTCAATGAATGGAT pLKO.1 2245 CDS 100% 0.300 0.210 N DIP2B n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript XM_006520976.3, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

No results found.