Transcript: Mouse XM_006521395.2

PREDICTED: Mus musculus family with sequence similarity 135, member B (Fam135b), transcript variant X2, mRNA.

Source:
NCBI, updated 2016-06-22
Taxon:
Mus musculus (mouse)
Gene:
Fam135b (70363)
Length:
16089
CDS:
4929..9140

Additional Resources:

NCBI RefSeq record:
XM_006521395.2
NBCI Gene record:
Fam135b (70363)

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Mouse XM_006521395.2, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Mouse Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000177698 CAGACGGATACATTTGCAGAT pLKO.1 8457 CDS 100% 4.050 5.670 N Fam135b n/a
2 TRCN0000217328 GATAATGCTGATCTGCGCAAA pLKO.1 8769 CDS 100% 4.050 5.670 N Fam135b n/a
3 TRCN0000184407 CCGACTCTATTTCCTGGTCAT pLKO.1 5693 CDS 100% 4.050 3.240 N Fam135b n/a
4 TRCN0000178164 GAATTAGCTTCATCGGCCATT pLKO.1 8551 CDS 100% 4.050 3.240 N Fam135b n/a
5 TRCN0000176596 CTAGCTTCTGACATACCATAT pLKO.1 8274 CDS 100% 10.800 7.560 N Fam135b n/a
6 TRCN0000216028 CACTTTGATCAGACATAATGT pLKO.1 8996 CDS 100% 5.625 3.938 N Fam135b n/a
7 TRCN0000176565 CTCAAGATCATTTGAGTTCTT pLKO.1 9180 3UTR 100% 0.495 0.347 N Fam135b n/a
8 TRCN0000198367 GCCAGTGTATGCAGAAATGAT pLKO.1 8936 CDS 100% 5.625 3.375 N Fam135b n/a
9 TRCN0000166364 CACACACACACACACACACAA pLKO.1 15088 3UTR 100% 4.950 2.475 Y KAAG1 n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript XM_006521395.2, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

No results found.