Transcript: Mouse XM_006521402.3

PREDICTED: Mus musculus protein phosphatase 6, regulatory subunit 2 (Ppp6r2), transcript variant X5, mRNA.

Source:
NCBI, updated 2019-08-08
Taxon:
Mus musculus (mouse)
Gene:
Ppp6r2 (71474)
Length:
4257
CDS:
452..3388

Additional Resources:

NCBI RefSeq record:
XM_006521402.3
NBCI Gene record:
Ppp6r2 (71474)

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Mouse XM_006521402.3, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Mouse Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000143209 GAACTATGCATAGCCGCTATT pLKO.1 1709 CDS 100% 10.800 15.120 N PPP6R2 n/a
2 TRCN0000217017 CAAGACCATTGGCAATCTTAT pLKO.1 826 CDS 100% 13.200 9.240 N Ppp6r2 n/a
3 TRCN0000257824 CAAGACCATTGGCAATCTTAT pLKO_005 826 CDS 100% 13.200 9.240 N Ppp6r2 n/a
4 TRCN0000248898 AGGTCCTACATTGGCTGAATG pLKO_005 993 CDS 100% 10.800 7.560 N Ppp6r2 n/a
5 TRCN0000248896 GTCCGATTCAAATACCCAAAC pLKO_005 668 CDS 100% 6.000 4.200 N Ppp6r2 n/a
6 TRCN0000144656 GCTGGACTTGTTCTTTAAGTA pLKO.1 1657 CDS 100% 5.625 3.938 N PPP6R2 n/a
7 TRCN0000190471 GCTGATGGATGAAGATGACAT pLKO.1 529 CDS 100% 4.950 2.970 N Ppp6r2 n/a
8 TRCN0000139407 GCAAGACCATTGGCAATCTCA pLKO.1 825 CDS 100% 3.000 2.100 N PPP6R2 n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript XM_006521402.3, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

Clone ID DNA Barcode Vector Sequenced %[?] Nuc. Match %[?] Prot. Match %[?] Epitope Tag Match Diffs[?] Addgene[?]
1 ccsbBroadEn_07471 pDONR223 100% 78.5% 77.1% None (many diffs) n/a
2 ccsbBroad304_07471 pLX_304 0% 78.5% 77.1% V5 (many diffs) n/a
Download CSV