Transcript: Mouse XM_006521504.3

PREDICTED: Mus musculus transmembrane protein 65 (Tmem65), transcript variant X1, mRNA.

Source:
NCBI, updated 2016-06-22
Taxon:
Mus musculus (mouse)
Gene:
Tmem65 (74868)
Length:
3956
CDS:
531..1316

Additional Resources:

NCBI RefSeq record:
XM_006521504.3
NBCI Gene record:
Tmem65 (74868)

sgRNA constructs matching this transcript (CRISPRko, NGG PAM)

This list includes CRISPRko constructs with 100% (20mer + NGG) sequence match to the coding regions of this transcript.

No results found.

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Mouse XM_006521504.3, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Mouse Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000250298 ATCACCTTAGAACACCTATAA pLKO_005 1316 CDS 100% 13.200 10.560 N Tmem65 n/a
2 TRCN0000250297 ACTATGGAAACACTAACTTAT pLKO_005 1440 3UTR 100% 13.200 9.240 N Tmem65 n/a
3 TRCN0000250301 ATTGTTGCAGGAACCCAAATT pLKO_005 1002 CDS 100% 13.200 9.240 N Tmem65 n/a
4 TRCN0000250300 TAGGAATGTTCCCGTTGATTT pLKO_005 1249 CDS 100% 13.200 9.240 N Tmem65 n/a
5 TRCN0000250299 CATGTGGCAAACACGTGTTAG pLKO_005 1184 CDS 100% 10.800 7.560 N Tmem65 n/a
6 TRCN0000138197 CCAGGACAGCTGAGATATGTA pLKO.1 924 CDS 100% 5.625 3.938 N TMEM65 n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript XM_006521504.3, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

Clone ID DNA Barcode Vector Sequenced %[?] Nuc. Match %[?] Prot. Match %[?] Epitope Tag Match Diffs[?] Addgene[?]
1 ccsbBroadEn_13301 pDONR223 100% 62.9% 64.7% None (many diffs) n/a
2 ccsbBroad304_13301 pLX_304 0% 62.9% 64.7% V5 (many diffs) n/a
Download CSV