Transcript: Mouse XM_006521609.3

PREDICTED: Mus musculus fer-1-like 6 (C. elegans) (Fer1l6), transcript variant X1, mRNA.

Source:
NCBI, updated 2019-08-08
Taxon:
Mus musculus (mouse)
Gene:
Fer1l6 (631797)
Length:
7806
CDS:
22..5613

Additional Resources:

NCBI RefSeq record:
XM_006521609.3
NBCI Gene record:
Fer1l6 (631797)

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Mouse XM_006521609.3, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Mouse Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000028246 GCTCCACTAGATACTCCAATA pLKO.1 2378 CDS 100% 10.800 15.120 N LOC383041 n/a
2 TRCN0000262869 TTGACTGGTGGTCTAAGTATT pLKO_005 3662 CDS 100% 13.200 9.240 N FER1L6 n/a
3 TRCN0000028265 CCTGATTTATGACCATGACAT pLKO.1 4305 CDS 100% 4.950 3.465 N LOC383041 n/a
4 TRCN0000028259 GCTGCCTTGAAGATATACGAT pLKO.1 3859 CDS 100% 3.000 2.100 N LOC383041 n/a
5 TRCN0000028229 GCTTTGAAGTTTCTGTTGGTA pLKO.1 1526 CDS 100% 3.000 2.100 N LOC383041 n/a
6 TRCN0000028285 CCTGAGAATGAACTGCTGCAT pLKO.1 3181 CDS 100% 2.640 1.848 N LOC383041 n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript XM_006521609.3, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

No results found.