Transcript: Mouse XM_006521721.2

PREDICTED: Mus musculus ATPase, H+ transporting, lysosomal V1 subunit A (Atp6v1a), transcript variant X3, mRNA.

Source:
NCBI, updated 2016-06-22
Taxon:
Mus musculus (mouse)
Gene:
Atp6v1a (11964)
Length:
3852
CDS:
216..2069

Additional Resources:

NCBI RefSeq record:
XM_006521721.2
NBCI Gene record:
Atp6v1a (11964)

sgRNA constructs matching this transcript (CRISPRko, NGG PAM)

This list includes CRISPRko constructs with 100% (20mer + NGG) sequence match to the coding regions of this transcript.

No results found.

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Mouse XM_006521721.2, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Mouse Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000029542 CCTACGGGTTGGTAGTCATAT pLKO.1 635 CDS 100% 13.200 18.480 N ATP6V1A n/a
2 TRCN0000240527 CCTACGGGTTGGTAGTCATAT pLKO_005 635 CDS 100% 13.200 18.480 N Atp6v1a n/a
3 TRCN0000280971 CCTACGGGTTGGTAGTCATAT pLKO_005 635 CDS 100% 13.200 18.480 N ATP6V1A n/a
4 TRCN0000182618 GCAAAGATCAAGGCCGACTAT pLKO.1 1998 CDS 100% 4.950 6.930 N Atp6v1a n/a
5 TRCN0000240528 ATGGGCTACCACGTCAGTATG pLKO_005 1233 CDS 100% 10.800 8.640 N Atp6v1a n/a
6 TRCN0000177330 GCAGGAAATACTTCCATTTAA pLKO.1 2532 3UTR 100% 15.000 10.500 N Atp6v1a n/a
7 TRCN0000240526 TAAGATCACATGGTCCATTAT pLKO_005 1904 CDS 100% 13.200 9.240 N Atp6v1a n/a
8 TRCN0000240525 TCTTTAGCAGAGACGGATAAA pLKO_005 1713 CDS 100% 13.200 9.240 N Atp6v1a n/a
9 TRCN0000182482 GCCACCATTCAGGTGTATGAA pLKO.1 399 CDS 100% 5.625 3.938 N Atp6v1a n/a
10 TRCN0000177329 GTCCAACATGATTTCATTCTA pLKO.1 1838 CDS 100% 5.625 3.938 N Atp6v1a n/a
11 TRCN0000181559 GCTTCCATATTGTGCAGCTTT pLKO.1 2145 3UTR 100% 4.950 3.465 N Atp6v1a n/a
12 TRCN0000182110 CCTCTTTAGCAGAGACGGATA pLKO.1 1711 CDS 100% 4.050 2.835 N Atp6v1a n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript XM_006521721.2, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

No results found.