Transcript: Mouse XM_006521800.2

PREDICTED: Mus musculus histone cell cycle regulator (Hira), transcript variant X3, mRNA.

Source:
NCBI, updated 2016-06-22
Taxon:
Mus musculus (mouse)
Gene:
Hira (15260)
Length:
4016
CDS:
348..3263

Additional Resources:

NCBI RefSeq record:
XM_006521800.2
NBCI Gene record:
Hira (15260)

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Mouse XM_006521800.2, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Mouse Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000365935 GAATACCGCCTCCGTGAAATA pLKO_005 3063 CDS 100% 13.200 18.480 N Hira n/a
2 TRCN0000374201 TTCGATTCCAGCGCCTCTTTA pLKO_005 3202 CDS 100% 13.200 18.480 N Hira n/a
3 TRCN0000365863 ACAAGTCCATCATGGATATTT pLKO_005 1198 CDS 100% 15.000 10.500 N Hira n/a
4 TRCN0000376683 AGGTCATTCTGGCTTAGTAAA pLKO_005 728 CDS 100% 13.200 9.240 N Hira n/a
5 TRCN0000081953 GCCGTGAAGTTCCCAGAAATT pLKO.1 693 CDS 100% 13.200 9.240 N Hira n/a
6 TRCN0000374202 TGGATAACACTGTTGTCATTT pLKO_005 667 CDS 100% 13.200 9.240 N Hira n/a
7 TRCN0000376754 TGGGTGGACATGGACTATATC pLKO_005 3417 3UTR 100% 13.200 9.240 N Hira n/a
8 TRCN0000365937 TTCAGGACCGTTAGCCATAAT pLKO_005 2855 CDS 100% 13.200 9.240 N Hira n/a
9 TRCN0000374203 ACTTGGGATCCCGTTGGTAAA pLKO_005 756 CDS 100% 10.800 7.560 N Hira n/a
10 TRCN0000081955 CTCAAGCTGATGATCGAAGTT pLKO.1 787 CDS 100% 4.950 3.465 N Hira n/a
11 TRCN0000081956 CCTCTCAAGCTGATGATCGAA pLKO.1 784 CDS 100% 3.000 2.100 N Hira n/a
12 TRCN0000081957 CCACTGCTCAGATCATCGAAA pLKO.1 958 CDS 100% 4.950 2.970 N Hira n/a
13 TRCN0000081954 CCAGCTTTCCACAGCTGTTAT pLKO.1 1382 CDS 100% 1.320 0.792 N Hira n/a
14 TRCN0000232158 TCAGGACCGTTAGCCATAATC pLKO_005 2856 CDS 100% 13.200 9.240 N HIRA n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript XM_006521800.2, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

No results found.