Transcript: Mouse XM_006521869.1

PREDICTED: Mus musculus sema domain, seven thrombospondin repeats (type 1 and type 1-like), transmembrane domain (TM) and short cytoplasmic domain, (semaphorin) 5B (Sema5b), transcript variant X1, mRNA.

Source:
NCBI, updated 2016-06-22
Taxon:
Mus musculus (mouse)
Gene:
Sema5b (20357)
Length:
4854
CDS:
500..3868

Additional Resources:

NCBI RefSeq record:
XM_006521869.1
NBCI Gene record:
Sema5b (20357)

sgRNA constructs matching this transcript (CRISPRko, NGG PAM)

This list includes CRISPRko constructs with 100% (20mer + NGG) sequence match to the coding regions of this transcript.

No results found.

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Mouse XM_006521869.1, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Mouse Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000418743 TGTACGAGTCCTGATTGTTTC pLKO_005 880 CDS 100% 10.800 15.120 N Sema5b n/a
2 TRCN0000094862 CGGGCTGTTTGCGTATTTCTT pLKO.1 1204 CDS 100% 5.625 7.875 N Sema5b n/a
3 TRCN0000094863 CCATCCATCCATATTGCCAAT pLKO.1 2285 CDS 100% 4.050 3.240 N Sema5b n/a
4 TRCN0000094861 CCGCAAGAGAACTTGTACCAA pLKO.1 3037 CDS 100% 3.000 2.400 N Sema5b n/a
5 TRCN0000442166 ATCTGAAGCCGTGGGTCTTTA pLKO_005 654 CDS 100% 13.200 9.240 N Sema5b n/a
6 TRCN0000094859 CCGTAGAACCACTTTGGTTTA pLKO.1 3929 3UTR 100% 10.800 7.560 N Sema5b n/a
7 TRCN0000094860 CCGGACTATTGAGAAGATCAA pLKO.1 976 CDS 100% 4.950 3.465 N Sema5b n/a
8 TRCN0000060474 CGGACTATTGAGAAGATCAAT pLKO.1 977 CDS 100% 0.563 0.394 N SEMA5B n/a
9 TRCN0000166364 CACACACACACACACACACAA pLKO.1 4722 3UTR 100% 4.950 2.475 Y KAAG1 n/a
10 TRCN0000172440 CACACACACACACACAGACAA pLKO.1 4748 3UTR 100% 4.950 2.475 Y LINC00955 n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript XM_006521869.1, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

No results found.