Transcript: Mouse XM_006521883.3

PREDICTED: Mus musculus F-box protein 40 (Fbxo40), transcript variant X3, mRNA.

Source:
NCBI, updated 2016-06-22
Taxon:
Mus musculus (mouse)
Gene:
Fbxo40 (207215)
Length:
5175
CDS:
572..2563

Additional Resources:

NCBI RefSeq record:
XM_006521883.3
NBCI Gene record:
Fbxo40 (207215)

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Mouse XM_006521883.3, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Mouse Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000252724 TTACGTTCACCTGCAACAAAT pLKO_005 1860 CDS 100% 13.200 18.480 N Fbxo40 n/a
2 TRCN0000252722 ATGCCAGGCTAGCACCAAATT pLKO_005 960 CDS 100% 13.200 9.240 N Fbxo40 n/a
3 TRCN0000217111 CGTGGATGCCAAAGACTATAA pLKO.1 1336 CDS 100% 13.200 9.240 N Fbxo40 n/a
4 TRCN0000252723 CGTGGATGCCAAAGACTATAA pLKO_005 1336 CDS 100% 13.200 9.240 N Fbxo40 n/a
5 TRCN0000252725 CTCCGGAGCTGAGTGAGAAAT pLKO_005 2085 CDS 100% 13.200 9.240 N Fbxo40 n/a
6 TRCN0000267444 GGAGCATCGATGGACTCTTTA pLKO_005 1683 CDS 100% 13.200 9.240 N Fbxo40 n/a
7 TRCN0000192820 GCTAGCACCAAATTCTTGTTT pLKO.1 967 CDS 100% 5.625 3.938 N Fbxo40 n/a
8 TRCN0000190370 CCTTCACGAGAACATCATGAA pLKO.1 760 CDS 100% 4.950 2.970 N Fbxo40 n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript XM_006521883.3, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

Clone ID DNA Barcode Vector Sequenced %[?] Nuc. Match %[?] Prot. Match %[?] Epitope Tag Match Diffs[?] Addgene[?]
1 ccsbBroadEn_03373 pDONR223 100% 78.9% 79.1% None (many diffs) n/a
2 ccsbBroad304_03373 pLX_304 0% 78.9% 79.1% V5 (many diffs) n/a
Download CSV