Transcript: Mouse XM_006521925.3

PREDICTED: Mus musculus pleckstrin homology like domain, family B, member 2 (Phldb2), transcript variant X7, mRNA.

Source:
NCBI, updated 2016-06-22
Taxon:
Mus musculus (mouse)
Gene:
Phldb2 (208177)
Length:
5805
CDS:
312..4244

Additional Resources:

NCBI RefSeq record:
XM_006521925.3
NBCI Gene record:
Phldb2 (208177)

sgRNA constructs matching this transcript (CRISPRko, NGG PAM)

This list includes CRISPRko constructs with 100% (20mer + NGG) sequence match to the coding regions of this transcript.

No results found.

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Mouse XM_006521925.3, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Mouse Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000105953 CCTAGTGGATAGTGACAATTA pLKO.1 1190 CDS 100% 13.200 18.480 N Phldb2 n/a
2 TRCN0000105952 CGGATCTGGATGGACGTTATA pLKO.1 4185 CDS 100% 13.200 18.480 N Phldb2 n/a
3 TRCN0000274983 GAGGATGCTCAGAGGTTATAA pLKO_005 3341 CDS 100% 15.000 12.000 N PHLDB2 n/a
4 TRCN0000274981 GACTATTCTGGCTCCTATTTA pLKO_005 471 CDS 100% 15.000 10.500 N PHLDB2 n/a
5 TRCN0000105954 GCCTAGTGGATAGTGACAATT pLKO.1 1189 CDS 100% 13.200 9.240 N Phldb2 n/a
6 TRCN0000105951 GCCCGAGGAAATACTCATCAA pLKO.1 427 CDS 100% 4.950 3.465 N Phldb2 n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript XM_006521925.3, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

No results found.