Transcript: Mouse XM_006522013.2

PREDICTED: Mus musculus calcineurin-like phosphoesterase domain containing 1 (Cpped1), transcript variant X1, mRNA.

Source:
NCBI, updated 2016-06-22
Taxon:
Mus musculus (mouse)
Gene:
Cpped1 (223978)
Length:
2804
CDS:
121..1131

Additional Resources:

NCBI RefSeq record:
XM_006522013.2
NBCI Gene record:
Cpped1 (223978)

sgRNA constructs matching this transcript (CRISPRko, NGG PAM)

This list includes CRISPRko constructs with 100% (20mer + NGG) sequence match to the coding regions of this transcript.

No results found.

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Mouse XM_006522013.2, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Mouse Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000080848 GCCCATTATTAGGAAGCACAA pLKO.1 2290 3UTR 100% 4.050 5.670 N Cpped1 n/a
2 TRCN0000325105 GCCCATTATTAGGAAGCACAA pLKO_005 2290 3UTR 100% 4.050 5.670 N Cpped1 n/a
3 TRCN0000080850 CGACTACTTCAACCTCACTAA pLKO.1 843 CDS 100% 4.950 3.960 N Cpped1 n/a
4 TRCN0000325183 CGACTACTTCAACCTCACTAA pLKO_005 843 CDS 100% 4.950 3.960 N Cpped1 n/a
5 TRCN0000080851 GCTGAACCCTAAACCCAAATT pLKO.1 423 CDS 100% 13.200 9.240 N Cpped1 n/a
6 TRCN0000325187 GCTGAACCCTAAACCCAAATT pLKO_005 423 CDS 100% 13.200 9.240 N Cpped1 n/a
7 TRCN0000080849 CGCCATTGTCTTCCAGCATAT pLKO.1 789 CDS 100% 10.800 7.560 N Cpped1 n/a
8 TRCN0000325185 CGCCATTGTCTTCCAGCATAT pLKO_005 789 CDS 100% 10.800 7.560 N Cpped1 n/a
9 TRCN0000080852 ACTGCGGAGAAGATTGTTCAT pLKO.1 1039 CDS 100% 4.950 3.465 N Cpped1 n/a
10 TRCN0000354036 ACTGCGGAGAAGATTGTTCAT pLKO_005 1039 CDS 100% 4.950 3.465 N Cpped1 n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript XM_006522013.2, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

No results found.