Transcript: Mouse XM_006522196.3

PREDICTED: Mus musculus ATPase type 13A5 (Atp13a5), transcript variant X1, mRNA.

Source:
NCBI, updated 2016-06-22
Taxon:
Mus musculus (mouse)
Gene:
Atp13a5 (268878)
Length:
4592
CDS:
232..3840

Additional Resources:

NCBI RefSeq record:
XM_006522196.3
NBCI Gene record:
Atp13a5 (268878)

sgRNA constructs matching this transcript (CRISPRko, NGG PAM)

This list includes CRISPRko constructs with 100% (20mer + NGG) sequence match to the coding regions of this transcript.

No results found.

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Mouse XM_006522196.3, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Mouse Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000101727 CCGATGAATTTCGAAGATATA pLKO.1 467 CDS 100% 13.200 18.480 N Atp13a5 n/a
2 TRCN0000101725 CCGTATTCATACTGTGTTGTT pLKO.1 4056 3UTR 100% 4.950 6.930 N Atp13a5 n/a
3 TRCN0000101726 GCTGCCACAAATTCTGGTTAA pLKO.1 2619 CDS 100% 10.800 7.560 N Atp13a5 n/a
4 TRCN0000101729 CCACTTATCCACACTGAAGTT pLKO.1 510 CDS 100% 4.950 3.465 N Atp13a5 n/a
5 TRCN0000101728 CCTGACTATGTACGGCATCAT pLKO.1 2907 CDS 100% 4.950 3.465 N Atp13a5 n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript XM_006522196.3, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

No results found.