Transcript: Mouse XM_006522248.2

PREDICTED: Mus musculus IQ calmodulin-binding motif containing 1 (Iqcb1), transcript variant X1, mRNA.

Source:
NCBI, updated 2016-06-22
Taxon:
Mus musculus (mouse)
Gene:
Iqcb1 (320299)
Length:
2308
CDS:
214..2010

Additional Resources:

NCBI RefSeq record:
XM_006522248.2
NBCI Gene record:
Iqcb1 (320299)

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Mouse XM_006522248.2, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Mouse Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000248094 AGCAACAAGTGGACGATTATG pLKO_005 1589 CDS 100% 13.200 18.480 N Iqcb1 n/a
2 TRCN0000248095 GACTTAGAAGTCTGCTAAATA pLKO_005 980 CDS 100% 15.000 10.500 N Iqcb1 n/a
3 TRCN0000248096 TGTACTGCAGAGTGATCATTT pLKO_005 699 CDS 100% 13.200 9.240 N Iqcb1 n/a
4 TRCN0000248093 TGTGAAAGCTGGCAATCTTAC pLKO_005 2018 3UTR 100% 10.800 7.560 N Iqcb1 n/a
5 TRCN0000248097 AGACTAAGTGCCTGCTATAAA pLKO_005 958 CDS 100% 15.000 9.000 N Iqcb1 n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript XM_006522248.2, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

Clone ID DNA Barcode Vector Sequenced %[?] Nuc. Match %[?] Prot. Match %[?] Epitope Tag Match Diffs[?] Addgene[?]
1 ccsbBroadEn_07460 pDONR223 100% 68.9% 68.2% None (many diffs) n/a
2 ccsbBroad304_07460 pLX_304 0% 68.9% 68.2% V5 (many diffs) n/a
3 TRCN0000477662 CACTCCCACCTTTCACAGCGTCTC pLX_317 15.9% 68.9% 68.2% V5 (many diffs) n/a
Download CSV