Construct: ORF TRCN0000477662
Construct Description:
- Construct Type:
- ORF
- Other Identifiers:
- ORF011190.1_s317c1
- Derived from:
- ccsbBroadEn_07460
- DNA Barcode:
- CACTCCCACCTTTCACAGCGTCTC
- Epitope Tag:
- V5
- Notes:
- No stop codon in insert
Originally Annotated References:
- Gene:
- IQCB1 (9657)
Vector Information:
- Vector Backbone:
- pLX_317
- Pol II Cassette 1:
- SV40-PuroR
- Pol II Cassette 2:
- EF1a-TRCN0000477662
- Selection Marker:
- PuroR
- Visible Reporter:
- n/a
- Epitope Tag:
- n/a
Current transcripts matched by this ORF:
| Taxon | Gene | Symbol | Description | Transcript | Nuc. Match %[?]A simple nucleotide-based global alignment percentage, calculated as follows: total nt. matches ---------------------------------- aligned length (incl. gaps) |
Prot. Match %[?]A simple amino acid-based global alignment percentage, calculated as follows: total aa. matches ---------------------------------- aligned length (incl. gaps) |
Match Diffs[?]This field may contain sequence annotations in HGVS format. For more information about HGVS annotations, please refer to the HGVS Quick Reference Guide. | |
|---|---|---|---|---|---|---|---|---|
| 1 | human | 9657 | IQCB1 | IQ motif containing B1 | NM_001023571.3 | 99.8% | 99.7% | 574C>T;902G>A |
| 2 | human | 9657 | IQCB1 | IQ motif containing B1 | NM_001023570.4 | 77.6% | 77.5% | 574C>T;585_983del;1301G>A |
| 3 | human | 9657 | IQCB1 | IQ motif containing B1 | NM_001319107.1 | 77.6% | 77.5% | 574C>T;585_983del;1301G>A |
| 4 | human | 9657 | IQCB1 | IQ motif containing B1 | XM_005247912.3 | 75.4% | 63.5% | (many diffs) |
| 5 | human | 9657 | IQCB1 | IQ motif containing B1 | XM_011513335.3 | 75.4% | 63.5% | (many diffs) |
| 6 | human | 9657 | IQCB1 | IQ motif containing B1 | XM_017007537.2 | 75.4% | 63.5% | (many diffs) |
| 7 | human | 9657 | IQCB1 | IQ motif containing B1 | XM_024453833.1 | 75.4% | 63.5% | (many diffs) |
| 8 | human | 9657 | IQCB1 | IQ motif containing B1 | XM_024453834.1 | 75.4% | 63.5% | (many diffs) |
| 9 | human | 9657 | IQCB1 | IQ motif containing B1 | XM_017007539.2 | 72.9% | 72.2% | (many diffs) |
| 10 | human | 9657 | IQCB1 | IQ motif containing B1 | XR_001740378.2 | 58% | (many diffs) | |
| 11 | human | 9657 | IQCB1 | IQ motif containing B1 | XM_005247911.4 | 56.7% | 56.1% | (many diffs) |
| 12 | human | 9657 | IQCB1 | IQ motif containing B1 | NR_134968.1 | 56% | (many diffs) | |
| 13 | human | 9657 | IQCB1 | IQ motif containing B1 | XR_001740379.2 | 51.8% | (many diffs) | |
| 14 | human | 9657 | IQCB1 | IQ motif containing B1 | XR_001740380.2 | 51.5% | (many diffs) | |
| 15 | human | 9657 | IQCB1 | IQ motif containing B1 | XR_001740376.2 | 49.5% | (many diffs) | |
| 16 | human | 9657 | IQCB1 | IQ motif containing B1 | XR_001740381.2 | 45.3% | (many diffs) | |
| 17 | human | 9657 | IQCB1 | IQ motif containing B1 | XR_001740377.2 | 43.3% | (many diffs) | |
| 18 | mouse | 320299 | Iqcb1 | IQ calmodulin-binding motif... | XM_017317037.1 | 88.6% | 87.7% | (many diffs) |
| 19 | mouse | 320299 | Iqcb1 | IQ calmodulin-binding motif... | NM_177128.4 | 68.9% | 68.2% | (many diffs) |
| 20 | mouse | 320299 | Iqcb1 | IQ calmodulin-binding motif... | XM_006522247.3 | 68.9% | 68.2% | (many diffs) |
| 21 | mouse | 320299 | Iqcb1 | IQ calmodulin-binding motif... | XM_006522248.2 | 68.9% | 68.2% | (many diffs) |
| 22 | mouse | 320299 | Iqcb1 | IQ calmodulin-binding motif... | XM_006522249.3 | 68.9% | 68.2% | (many diffs) |
| 23 | mouse | 320299 | Iqcb1 | IQ calmodulin-binding motif... | XM_006522250.3 | 45.7% | 43.4% | (many diffs) |
Sequence Information
Note: uppercase bases indicate empirically verified sequence.
- ORF start:
- 66
- ORF end:
- 1461
- ORF length:
- 1395
- Sequence:
-
1 tcttccattt caggtgtcgt gaggctagca tcgattgatc aacaagtttg tacaaaaaag 61 ttggcatgaa gccaacaggt acagacccaa ggatcttatc tatagctgct gaagttgcaa 121 aaagccctga gcagaatgtc cctgttatac tgttgaagtt aaaagaaata ataaacatca 181 cacctttagg aagctcagag ttgaagaaaa tcaaacaaga tatatattgt tatgatctca 241 ttcaatattg cctcttggtc ctcagtcaag attattctcg aatccagggt ggttggacta 301 caatttccca gcttacacag atattaagcc attgctgtgt gggcttggag ccaggagaag 361 atgcagagga attttacaat gaattacttc catcagctgc agaaaatttt ctagttttgg 421 ggagacaatt acaaacatgt tttatcaatg cagctaaggc tgaagaaaaa gatgaattac 481 tacacttttt ccaaattgtg actgattctc tcttctggct tttgggaggc catgttgaac 541 ttattcagaa tgtactacaa agtgatcatt tcttacattt actgcaagct gacaatgtcc 601 aaataggatc tgcagtcatg atgatgctac agaatatatt acagatcaac agatccaaac 661 gatcaaagat gttgctggag ataaataggc agaaggaaga agaggacctc aaattacaat 721 tgcaacttca aagacagaga gccatgagac tttcccgaga attgcagctg agtatgctcg 781 aaatagttca tccaggtcag gtggagaaac actatcggga aatggaagag aaatcagcac 841 tgattatcca gaaacattgg agagggtaca gggaaaggaa aaattttcac caacagaggc 901 agtctctcat agagtataaa gcagctgtca cacttcaaag agcagcgctt aaattcctag 961 cgaagtaccg taagaaaaag aaactatttg ctccttggcg aggactccaa gaactcactg 1021 atgcacgccg agttgaactg aagaaacgag tggatgacta tgtcagaaga catttgggct 1081 ctccaatgtc agatgtggtc agtagggagc tccatgccca agctcaagaa cgactgcaac 1141 actactttat gggcagggcc ctagaagagc gagcccagca gcacagagaa gctctgatag 1201 cacagatcag caccaacgtt gaacagctaa tgaaggcacc aagtcTGAAG GAGGCAGAAG 1261 GGAAAGAACC TGAGCTCTTC CTAAGTAGAT CCAGGCCTGT GGCAGCCAAG GCCAAGCAGG 1321 CCCATCTCAC AACCCTGAAG CACATACAAG CACCCTGGTG GAAGAAGCTT GGAGAAGAAT 1381 CTGGAGATGA GATTGATGTT CCAAAGGATG AGCTTAGTAT AGAATTAGAA AATTTATTCA 1441 TTGGTGGAAC CAAACCACCT TACCCAACTT TCTTGTACAA AGTGGTTGAT ATCGGTAAGC 1501 CTATCCCTAA CCCTCTCCTC GGTCTCGATT CTACGTAGTA ATGAACTAGT CCGTAACTTG 1561 AAAGTATTTC GATTTCTTGG CTTTATATAT CTTGTGGAAA GGACGACACT CCCACCTTTC 1621 ACAGCGTCTC ACGCGTTAAG TCgacaatca acctctggat tacaaaattt gtgaaagatt