Transcript: Mouse XM_006522352.1

PREDICTED: Mus musculus SLX4 structure-specific endonuclease subunit homolog (S. cerevisiae) (Slx4), transcript variant X4, mRNA.

Source:
NCBI, updated 2016-06-22
Taxon:
Mus musculus (mouse)
Gene:
Slx4 (52864)
Length:
5807
CDS:
172..5112

Additional Resources:

NCBI RefSeq record:
XM_006522352.1
NBCI Gene record:
Slx4 (52864)

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Mouse XM_006522352.1, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Mouse Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000249953 GCCTCCCAAAGTGCCTATAAC pLKO_005 4269 CDS 100% 13.200 18.480 N Slx4 n/a
2 TRCN0000257946 AGGCGCTATATCCGCTCTAAG pLKO_005 4876 CDS 100% 10.800 15.120 N Slx4 n/a
3 TRCN0000249954 CAAGCACAGCTGCCCTATATT pLKO_005 5422 3UTR 100% 15.000 10.500 N Slx4 n/a
4 TRCN0000249951 GCCACACACACAGCCTATTAC pLKO_005 3627 CDS 100% 13.200 9.240 N Slx4 n/a
5 TRCN0000249952 TGCGAGATGCCCACTTCTTAT pLKO_005 1863 CDS 100% 13.200 9.240 N Slx4 n/a
6 TRCN0000200336 GCAACGGATGAAGCAGTTCAA pLKO.1 393 CDS 100% 4.950 3.465 N Slx4 n/a
7 TRCN0000182411 GCCCGAAAGGAGAAACTCAAA pLKO.1 5044 CDS 100% 4.950 3.465 N Slx4 n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript XM_006522352.1, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

No results found.