Transcript: Mouse XM_006522482.4

PREDICTED: Mus musculus bMERB domain containing 1 (Bmerb1), transcript variant X1, mRNA.

Source:
NCBI, updated 2019-08-08
Taxon:
Mus musculus (mouse)
Gene:
Bmerb1 (67254)
Length:
5814
CDS:
260..667

Additional Resources:

NCBI RefSeq record:
XM_006522482.4
NBCI Gene record:
Bmerb1 (67254)

sgRNA constructs matching this transcript (CRISPRko, NGG PAM)

This list includes CRISPRko constructs with 100% (20mer + NGG) sequence match to the coding regions of this transcript.

No results found.

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Mouse XM_006522482.4, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Mouse Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000430856 ACAAGTCCCGTTCCCTGTTTG pLKO_005 1102 3UTR 100% 10.800 15.120 N Bmerb1 n/a
2 TRCN0000114401 GCTGCAAATGAGTACATACAA pLKO.1 1478 3UTR 100% 5.625 7.875 N Bmerb1 n/a
3 TRCN0000114405 GAACGCTTAAGGGAACAGGAA pLKO.1 461 CDS 100% 2.640 3.696 N Bmerb1 n/a
4 TRCN0000114403 GCACTCATCAAGGATTGCTGT pLKO.1 620 CDS 100% 2.640 3.696 N Bmerb1 n/a
5 TRCN0000418888 AGGAGTCTGTCTTATCATTTA pLKO_005 896 3UTR 100% 13.200 9.240 N Bmerb1 n/a
6 TRCN0000432577 GAGAAGCCTCTCAGGCGTTAT pLKO_005 219 5UTR 100% 10.800 7.560 N Bmerb1 n/a
7 TRCN0000442581 GATCCACAGACTGGTACAGAA pLKO_005 409 CDS 100% 4.950 2.970 N Bmerb1 n/a
8 TRCN0000152026 CCTCTAGACAAAGTAACCAAA pLKO.1 524 CDS 100% 4.950 3.465 N BMERB1 n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript XM_006522482.4, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

Clone ID DNA Barcode Vector Sequenced %[?] Nuc. Match %[?] Prot. Match %[?] Epitope Tag Match Diffs[?] Addgene[?]
1 ccsbBroadEn_04498 pDONR223 100% 61.7% 61.2% None (many diffs) n/a
2 ccsbBroad304_04498 pLX_304 0% 61.7% 61.2% V5 (many diffs) n/a
Download CSV